View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_149 (Length: 264)
Name: NF1199_high_149
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_149 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 26 - 230
Target Start/End: Original strand, 6922024 - 6922228
Alignment:
| Q |
26 |
aggatccacatgcaaatttgtttacaaaattaacacaagttgcatattgtagcttcttctaaccccttactccaaaggatagggtcttgattaattggac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6922024 |
aggatccacatgcaaatttgtttacaaaattaacacaagttgcatattgtagcttcttctaaccccttactccaaaggatagggtcttgattaattggac |
6922123 |
T |
|
| Q |
126 |
ctttgtaggtttgccatatcattgacagcttcatttctcacgtgcttgtgcaagtgcatggctaatttgacacacttgatttttgtaccattttatgtcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6922124 |
ctttgtaggtttgccatatcattgacagcttcatttctcacgtgcttgtgcaagtgcatagctaatttgacacacttgatttttgtaccattttatgtcc |
6922223 |
T |
|
| Q |
226 |
ttcct |
230 |
Q |
| |
|
||||| |
|
|
| T |
6922224 |
ttcct |
6922228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University