View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_158 (Length: 251)
Name: NF1199_high_158
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_158 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 23 - 244
Target Start/End: Complemental strand, 2597005 - 2596785
Alignment:
| Q |
23 |
gatggtcaacaatatatttataagtggagacattcctcatctcatcagtcaattttgtcagattatattagactcaaccataattttctaaaagtaacca |
122 |
Q |
| |
|
|||| ||||||||||| |||||||||||| |||||||||||||| |||| ||||| ||||||| | |||||||||||| ||| || |||||| |||||| |
|
|
| T |
2597005 |
gatgatcaacaatatacttataagtggaggtattcctcatctcattagtcgattttatcagattgtgttagactcaaccgtaactt-ctaaaactaacca |
2596907 |
T |
 |
| Q |
123 |
taaagagatgatttttgttcttgtatttctctcttacctcactttcttttccctacnnnnnnnaaccgatcacaccttaagtgcaaaatttgtaataatg |
222 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2596906 |
tgaagagatgatttttgctcttgtatttctctcttacctcactttcttttccctactttttttaaccgatcacaccttaagtgcaaaatttgtcataatg |
2596807 |
T |
 |
| Q |
223 |
agaagcttgtgaacctatgata |
244 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
2596806 |
agaagcttgtgaacctaagata |
2596785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 39 - 108
Target Start/End: Complemental strand, 42985197 - 42985128
Alignment:
| Q |
39 |
tttataagtggagacattcctcatctcatcagtcaattttgtcagattatattagactcaaccataattt |
108 |
Q |
| |
|
||||||||||||| || |||||| |||| |||| ||||||| || || | ||||||||||||||||||| |
|
|
| T |
42985197 |
tttataagtggaggcaatcctcacctcacaagtcgattttgtgaggttgtgttagactcaaccataattt |
42985128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University