View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_170 (Length: 248)
Name: NF1199_high_170
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_170 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] scaffold0581 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 35 - 248
Target Start/End: Original strand, 25617204 - 25617418
Alignment:
| Q |
35 |
gcagtttaagagtatattcatataaatctcttggtggacacaaaa-catactgaaagagtgacaaaaatggtgattttatagattggaaatattagtagt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25617204 |
gcagtttaagagtatattcatataaatctcttggtggacacaaaaacatactgaaagagtgacaaaaatggtgattatatagattggaaatattagtagt |
25617303 |
T |
 |
| Q |
134 |
atccatattgtaacatagtattcaatcttgctcaagcagtaggtggacaaaagaaggtacacatttccaatcatataacactttgccgtaccatctttcg |
233 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25617304 |
atccatattgtaacatagtattcaattttgctcaagcagtaggtggacgaaagaaggtacacgtttccaatcatataacactttgccgtaccatctttca |
25617403 |
T |
 |
| Q |
234 |
tccaattagtgctta |
248 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
25617404 |
tccaatgagtgctta |
25617418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0581 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: scaffold0581
Description:
Target: scaffold0581; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 35 - 215
Target Start/End: Complemental strand, 5705 - 5525
Alignment:
| Q |
35 |
gcagtttaagagtatattcatataaatctcttggtggacacaaaacatactgaaagagtgacaaaaatggtgattttatagattggaaatattagtagta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5705 |
gcagtttaagagtatattcatataaatctcttggtggacacaaaacatactgaaagagtgacaaaaatggtgatcttatagattggaaatattagtagta |
5606 |
T |
 |
| Q |
135 |
tccatattgtaacatagtattcaatcttgctcaagcagtaggtggacaaaagaaggtacacatttccaatcatataacact |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5605 |
tccatattgtaacatagtattcaattttgctcaagcagtaggtggacaaaagaaggtacacgtttccaatcatataacact |
5525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0581; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 117
Target Start/End: Original strand, 5889 - 5937
Alignment:
| Q |
69 |
tggacacaaaacatactgaaagagtgacaaaaatggtgattttatagat |
117 |
Q |
| |
|
|||||||||| ||||||| || |||||||| |||| ||||||||||||| |
|
|
| T |
5889 |
tggacacaaatcatactgtaaaagtgacaataatgatgattttatagat |
5937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University