View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_172 (Length: 244)
Name: NF1199_high_172
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_172 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 23 - 244
Target Start/End: Complemental strand, 25244060 - 25243838
Alignment:
| Q |
23 |
aaaacatcgtcgtcgaccgcatatttgaaatcctccggcaccgaaggatatagtcttagtgtctcagcc-aatgcagcttttagataaacaagcttctct |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25244060 |
aaaacatcgtcgtcgaccgcatatttgaaatcctccggcaccgaaggatatagtcttagtgtctcagcccaatgcagcttttagataaacaagcttctct |
25243961 |
T |
 |
| Q |
122 |
gcttcctcaaaatccacggcttcctccgtccaccggcgagaatcaccaccgcgagtttcagccaaaaccgccgttaactctgctagaatcttctcctcca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25243960 |
gcttcctcaaaatccacggcttcctccgtccaccggcgagaatcaccaccgcgagtttcagccaaaaccgccgttaactctgctagaatcttctcctcca |
25243861 |
T |
 |
| Q |
222 |
cgctaggatgattcatgacaagc |
244 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25243860 |
cgctaggatgattcatgacaagc |
25243838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 11315382 - 11315322
Alignment:
| Q |
51 |
aatcctccggcaccgaaggatatagtcttagtgtctcagccaatgcagcttttagataaac |
111 |
Q |
| |
|
||||||| ||||||||||| || || ||||||||||| | ||| |||||||| |||||||| |
|
|
| T |
11315382 |
aatcctctggcaccgaagggtacagccttagtgtctccgacaaggcagctttaagataaac |
11315322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University