View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_high_192 (Length: 209)

Name: NF1199_high_192
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_high_192
NF1199_high_192
[»] scaffold1528 (1 HSPs)
scaffold1528 (1-58)||(700-757)
[»] chr1 (1 HSPs)
chr1 (1-58)||(17753976-17754033)


Alignment Details
Target: scaffold1528 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: scaffold1528
Description:

Target: scaffold1528; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 700 - 757
Alignment:
1 ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctgggatattattg 58  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||    
700 ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctaggattttattg 757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 17753976 - 17754033
Alignment:
1 ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctgggatattattg 58  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||    
17753976 ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctaggattttattg 17754033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University