View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_197 (Length: 201)
Name: NF1199_high_197
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_197 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 24 - 88
Target Start/End: Complemental strand, 43478619 - 43478555
Alignment:
| Q |
24 |
ttctttctcggtgatatgtatacgtatcaatttattagtatattatagccaataactacacgatt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43478619 |
ttctttctcggtgatatgtatacgtatcaatttattagtatattatagccaataactacacgatt |
43478555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University