View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_high_54 (Length: 463)
Name: NF1199_high_54
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_high_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 85 - 434
Target Start/End: Original strand, 51414623 - 51414977
Alignment:
| Q |
85 |
tcttttgatgaagatcatcaatcacatgatgcttatcacttagttgatcattttcaatgttaatcaacactatcttgcttcttagctaattaagattata |
184 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51414623 |
tcttttgatggagatcatcaatcatatgatgcttatcacttagttgatcatttccaatgttaatcaacactatcttgcttcttagctaattaagattata |
51414722 |
T |
|
| Q |
185 |
gtgatgttaannnnnnnaagggatataaagatattaatatgatgcttatatttaaaacattagtttgttctcttttatggagtttatggtgttg-----g |
279 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51414723 |
atgatgttaatttttttaagggatataaagatgttaatatgatgcttatatttaaaaaattagtttgttctcttttatggagtttatggtgttgggttgg |
51414822 |
T |
|
| Q |
280 |
tcatgggtctttggttgctagtatggtttatgggtcttttaaggtgtcttggcttccaagtaagcatgctgaggtataaataacatttttatagtcttaa |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51414823 |
tcatgggtctttggttgctagtatggtttatgggtcttttaaggtgtcttggcttccaagtaagcatgctgaggtataaataacatttttatagtcttaa |
51414922 |
T |
|
| Q |
380 |
nnnnnnncataagctttcaatcaaattgagaattcaatctttagatttaattaag |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51414923 |
tttttttcataagctttcaatcaaattgagaattcaatctttagatttaattaag |
51414977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University