View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_110 (Length: 378)
Name: NF1199_low_110
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_110 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 105 - 349
Target Start/End: Original strand, 5138032 - 5138276
Alignment:
| Q |
105 |
ctacctttctgaaacatgctcacatcactagctgaattggcaactttaaagtgtgaccaattaagcacatcaacttcaaagtctccatttttatgcaact |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5138032 |
ctacctttctgaaacatgctcgcatcactagctgaattggcaactttaaagtgtgaccaattaagcacatcaacttcaaagtctccatttttatgcaact |
5138131 |
T |
|
| Q |
205 |
ccagaaaagggtgttcttcaaaacgcgaactttcatcaccttcagctggcaaagttgaaattctgacagtgtcattcaacgatacagaacgaccctttga |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5138132 |
ccagaaaagggtgttcttcaaaacgcgaactttcatcaccttcagctggcaaagttgaaattttgacagtgtcattcaacgatacagaacgaccctttga |
5138231 |
T |
|
| Q |
305 |
actgaaactactttgtcgaaaagaatcaagcaaagaactaaaagg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5138232 |
actgaaactactttgtcgaaaagaatcaagcaaagaactaaaagg |
5138276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 9 - 54
Target Start/End: Original strand, 5137930 - 5137975
Alignment:
| Q |
9 |
caagaatattcaaaattccttaaagaaaatgtctacagtaatgact |
54 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5137930 |
caagaatattcaaaattccttaaaaaaaatgtctacagtaatgact |
5137975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University