View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_114 (Length: 373)
Name: NF1199_low_114
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_114 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 30 - 365
Target Start/End: Complemental strand, 42924167 - 42923832
Alignment:
| Q |
30 |
ttcgccgtctgagtcattgctgcttggagttccctcgctccagttcagtacatccgacgggttcccgcggtcggagaaaacattccggcggaactccgtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42924167 |
ttcgccgtctgagtcattgctgcttggagttccctcgctccagttcagtacatccgacgggttcccgcggtcggagaaaacattccggcggaactccgtc |
42924068 |
T |
 |
| Q |
130 |
ccctgagaagggaaaaactgatcacgattgacggtgaacattttgtcgtcgatgaaaccgccggttttaggaaccggatcaccgacctgtcgcggtggtg |
229 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42924067 |
ccctgagaagggaaaaactgatcgcgattgacagtgaacattttgtcgtcgatgaaaccgccggttttaggaaccggatcaccgacctgtcgcggtggtg |
42923968 |
T |
 |
| Q |
230 |
caccgccgcagttgaagcgtagagagtggtctgggaatacgagaggggaagtaaggccgttttctattctttgatcgggagtgagattgatgtcatcgga |
329 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42923967 |
caccgccgcagttgaagcgcagagagtggtctgggaatacgagaggggaagtaaggccgttttctattctttgatcaggagtgagattgatgtcatcgga |
42923868 |
T |
 |
| Q |
330 |
agacatggtgcgaacggtaaagctcgaatctgtggt |
365 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |
|
|
| T |
42923867 |
agacatggtgcgaacggtgaagctcgaatttgtggt |
42923832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University