View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_low_122 (Length: 356)

Name: NF1199_low_122
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_low_122
NF1199_low_122
[»] chr6 (14 HSPs)
chr6 (104-356)||(2104980-2105234)
chr6 (125-246)||(5253222-5253346)
chr6 (125-246)||(8611973-8612097)
chr6 (128-235)||(29444775-29444885)
chr6 (125-246)||(12635801-12635925)
chr6 (125-246)||(21898635-21898759)
chr6 (189-246)||(9633624-9633681)
chr6 (189-246)||(14107357-14107414)
chr6 (125-172)||(33859395-33859442)
chr6 (196-246)||(3030642-3030692)
chr6 (196-246)||(30788852-30788902)
chr6 (125-166)||(29333220-29333261)
chr6 (125-185)||(9179799-9179859)
chr6 (125-212)||(19230592-19230680)
[»] chr7 (20 HSPs)
chr7 (125-246)||(5069814-5069938)
chr7 (125-246)||(17748381-17748505)
chr7 (125-246)||(38578866-38578990)
chr7 (125-246)||(22993366-22993490)
chr7 (125-182)||(18785655-18785712)
chr7 (125-182)||(43925498-43925555)
chr7 (125-246)||(13095844-13095968)
chr7 (125-182)||(1605927-1605984)
chr7 (125-182)||(1797446-1797503)
chr7 (125-182)||(26423353-26423410)
chr7 (189-246)||(43346778-43346835)
chr7 (125-236)||(23658165-23658279)
chr7 (125-177)||(45447956-45448008)
chr7 (125-246)||(22973953-22974077)
chr7 (129-246)||(27028269-27028389)
chr7 (125-182)||(10047942-10047999)
chr7 (129-182)||(10317811-10317864)
chr7 (125-182)||(47341862-47341919)
chr7 (125-173)||(34127695-34127743)
chr7 (142-182)||(39474943-39474983)
[»] chr3 (27 HSPs)
chr3 (133-246)||(28572211-28572327)
chr3 (125-246)||(15320169-15320293)
chr3 (125-246)||(29127902-29128026)
chr3 (125-246)||(35315939-35316063)
chr3 (125-246)||(7328827-7328950)
chr3 (125-243)||(26207804-26207925)
chr3 (125-235)||(30767258-30767371)
chr3 (141-246)||(7650226-7650334)
chr3 (125-246)||(47749105-47749228)
chr3 (125-246)||(54261209-54261333)
chr3 (189-246)||(7310703-7310760)
chr3 (125-182)||(31072861-31072918)
chr3 (125-182)||(45877437-45877494)
chr3 (125-246)||(13893909-13894033)
chr3 (125-245)||(3507534-3507657)
chr3 (125-182)||(15795561-15795617)
chr3 (190-246)||(36043674-36043730)
chr3 (125-177)||(48342003-48342055)
chr3 (147-237)||(50405612-50405705)
chr3 (137-183)||(10855379-10855425)
chr3 (189-235)||(19873422-19873468)
chr3 (125-246)||(47219127-47219251)
chr3 (125-246)||(47471815-47471938)
chr3 (141-182)||(30045820-30045861)
chr3 (125-182)||(49198334-49198391)
chr3 (125-177)||(7612998-7613050)
chr3 (125-177)||(42412846-42412898)
[»] chr2 (30 HSPs)
chr2 (125-246)||(10823043-10823167)
chr2 (126-237)||(7787040-7787154)
chr2 (132-246)||(12455300-12455417)
chr2 (125-246)||(8410114-8410238)
chr2 (125-246)||(9360747-9360871)
chr2 (125-246)||(25540403-25540527)
chr2 (125-236)||(331484-331598)
chr2 (125-246)||(7747257-7747381)
chr2 (125-176)||(15079466-15079517)
chr2 (125-246)||(18902529-18902653)
chr2 (125-246)||(41031905-41032028)
chr2 (125-246)||(41220618-41220742)
chr2 (141-245)||(16636065-16636172)
chr2 (125-182)||(29653610-29653667)
chr2 (125-182)||(34356189-34356246)
chr2 (125-176)||(21286427-21286478)
chr2 (125-246)||(2528340-2528464)
chr2 (125-246)||(3643886-3644010)
chr2 (125-246)||(11069861-11069985)
chr2 (125-246)||(38005385-38005509)
chr2 (189-246)||(18649025-18649082)
chr2 (125-182)||(19976873-19976930)
chr2 (189-246)||(28616378-28616435)
chr2 (125-182)||(38962746-38962803)
chr2 (125-182)||(39806951-39807008)
chr2 (141-182)||(40968981-40969022)
chr2 (189-246)||(44945643-44945700)
chr2 (202-246)||(792217-792261)
chr2 (125-177)||(29422198-29422250)
chr2 (189-245)||(29482280-29482336)
[»] chr5 (22 HSPs)
chr5 (125-246)||(8513503-8513627)
chr5 (125-246)||(9812856-9812980)
chr5 (125-246)||(12704998-12705122)
chr5 (125-246)||(5731919-5732043)
chr5 (125-183)||(20692917-20692975)
chr5 (125-246)||(42086311-42086435)
chr5 (125-246)||(7866565-7866689)
chr5 (125-246)||(20682616-20682740)
chr5 (125-182)||(1898985-1899042)
chr5 (189-246)||(2485247-2485304)
chr5 (125-182)||(11845867-11845924)
chr5 (125-182)||(15034059-15034116)
chr5 (125-182)||(25417249-25417306)
chr5 (189-246)||(27648424-27648481)
chr5 (125-177)||(35403583-35403635)
chr5 (125-176)||(35813070-35813121)
chr5 (196-246)||(38296729-38296779)
chr5 (125-166)||(6767133-6767174)
chr5 (125-182)||(28857112-28857169)
chr5 (125-170)||(30349563-30349608)
chr5 (189-246)||(40773324-40773381)
chr5 (125-185)||(23247414-23247474)
[»] chr8 (21 HSPs)
chr8 (125-246)||(10927593-10927717)
chr8 (125-246)||(17981428-17981552)
chr8 (125-246)||(8141089-8141213)
chr8 (125-246)||(44893277-44893401)
chr8 (125-245)||(15884556-15884678)
chr8 (125-183)||(1013042-1013100)
chr8 (125-246)||(14666070-14666194)
chr8 (125-246)||(33401799-33401922)
chr8 (125-182)||(2467184-2467241)
chr8 (189-246)||(8803108-8803165)
chr8 (125-182)||(38922480-38922537)
chr8 (125-182)||(44031506-44031563)
chr8 (137-246)||(26570923-26571035)
chr8 (125-216)||(583801-583893)
chr8 (201-246)||(1653859-1653904)
chr8 (201-246)||(1742235-1742280)
chr8 (125-182)||(6100459-6100516)
chr8 (125-182)||(22276546-22276603)
chr8 (189-246)||(43027359-43027416)
chr8 (125-177)||(34710638-34710690)
chr8 (125-185)||(34846801-34846860)
[»] chr4 (27 HSPs)
chr4 (125-246)||(7246645-7246769)
chr4 (125-246)||(38166015-38166139)
chr4 (125-243)||(1940779-1940897)
chr4 (125-246)||(55921022-55921146)
chr4 (125-182)||(36145281-36145338)
chr4 (125-246)||(36262766-36262888)
chr4 (125-246)||(47078446-47078570)
chr4 (125-237)||(8889010-8889125)
chr4 (125-246)||(2559295-2559419)
chr4 (125-246)||(30317221-30317345)
chr4 (125-246)||(42722576-42722700)
chr4 (128-177)||(29588727-29588776)
chr4 (129-182)||(43468339-43468392)
chr4 (125-216)||(41339424-41339518)
chr4 (125-246)||(3159468-3159592)
chr4 (125-246)||(29895775-29895899)
chr4 (125-246)||(38168245-38168368)
chr4 (125-182)||(1446814-1446871)
chr4 (141-182)||(10541020-10541061)
chr4 (189-246)||(31588741-31588798)
chr4 (189-246)||(37369041-37369098)
chr4 (125-182)||(41162948-41163005)
chr4 (189-246)||(47682381-47682438)
chr4 (189-246)||(50485998-50486055)
chr4 (125-182)||(52950070-52950127)
chr4 (125-182)||(53599048-53599105)
chr4 (198-246)||(48834699-48834747)
[»] scaffold0006 (1 HSPs)
scaffold0006 (125-243)||(68503-68621)
[»] scaffold0002 (3 HSPs)
scaffold0002 (125-246)||(556-680)
scaffold0002 (125-182)||(319408-319465)
scaffold0002 (125-182)||(412092-412149)
[»] chr1 (17 HSPs)
chr1 (125-246)||(18915851-18915975)
chr1 (127-246)||(2980931-2981053)
chr1 (125-236)||(40288487-40288601)
chr1 (128-246)||(43959821-43959942)
chr1 (125-246)||(30927727-30927851)
chr1 (141-246)||(15465965-15466073)
chr1 (125-172)||(9853354-9853401)
chr1 (125-246)||(41663856-41663980)
chr1 (128-182)||(45536695-45536749)
chr1 (125-182)||(49078098-49078155)
chr1 (166-246)||(50371834-50371917)
chr1 (187-246)||(3850742-3850801)
chr1 (136-246)||(34697330-34697443)
chr1 (125-246)||(33004015-33004139)
chr1 (125-182)||(31152700-31152757)
chr1 (125-182)||(34334362-34334419)
chr1 (128-176)||(48798143-48798191)
[»] scaffold0376 (1 HSPs)
scaffold0376 (125-246)||(12656-12780)
[»] scaffold0029 (1 HSPs)
scaffold0029 (127-246)||(41032-41154)
[»] scaffold0011 (1 HSPs)
scaffold0011 (189-246)||(224370-224427)
[»] scaffold0005 (1 HSPs)
scaffold0005 (125-182)||(271140-271197)
[»] scaffold0086 (1 HSPs)
scaffold0086 (125-212)||(26169-26259)
[»] scaffold0009 (2 HSPs)
scaffold0009 (131-246)||(42831-42949)
scaffold0009 (125-183)||(9422-9480)
[»] scaffold0332 (1 HSPs)
scaffold0332 (125-167)||(15317-15359)
[»] scaffold0209 (1 HSPs)
scaffold0209 (125-216)||(12561-12653)
[»] scaffold0079 (1 HSPs)
scaffold0079 (125-182)||(8161-8217)
[»] scaffold0010 (1 HSPs)
scaffold0010 (189-246)||(155710-155767)


Alignment Details
Target: chr6 (Bit Score: 181; Significance: 1e-97; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 104 - 356
Target Start/End: Complemental strand, 2105234 - 2104980
Alignment:
104 agttatttgggcttggcaaggaaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatggcttctacgtacgagtcg 203  Q
    |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||||    
2105234 agttgtttggacttggcaaggaaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggccagtatggcctctacgtacaagtcg 2105135  T
204 gattagtcgcccattttttgtgggtcggaaaccgatgcgaaagnnnnnnnntgctaaaaacgtatcatcaagtattgtcatagtcacattgttccgtaaa 303  Q
    |||||||||| || ||||| |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||    
2105134 gattagtcgctcactttttatgggtcggaaaccgatgcgaaag-aaaaaaatgctaaaaacgtatcatcaagtattgtcatagtcacattgttccgtaaa 2105036  T
304 aaatagcagaagaatatata---aagaagaaaatttacctctctttttccactgct 356  Q
    ||||||||||||||||||||   |||||||||||||||||||||||||||||||||    
2105035 aaatagcagaagaatatataaagaagaagaaaatttacctctctttttccactgct 2104980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 5253346 - 5253222
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||||| |||||| ||||| ||||  |   || |||||| | ||| ||||||| |||||||  |||    
5253346 aaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccaccttt 5253247  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
5253246 ggtgggtcggaaaccggtgcgaaag 5253222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 8612097 - 8611973
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||| | |||||||||||  |||| ||   ||||||||| | ||  |||||||||||||||  |||    
8612097 aaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccaccttt 8611998  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||| ||||||||    
8611997 ggtgggtcagaaaccggtgcgaaag 8611973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 128 - 235
Target Start/End: Complemental strand, 29444885 - 29444775
Alignment:
128 gacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgt 224  Q
    ||||||||||||  ||||||||||||||||||||||| |||||||||||| ||||  |   || |||||| | ||| ||||||||| | |||| ||| ||    
29444885 gacgtacccgggggataccgggttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctttggt 29444786  T
225 gggtcggaaac 235  Q
    |||||||||||    
29444785 gggtcggaaac 29444775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 12635801 - 12635925
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||| |||| |||| | ||||||||||||||||||  |||  |   || |||||| || || ||||||||||||||| | ||    
12635801 aaggacgtatccggggaataccaggtttgattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactatt 12635900  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
12635901 ggtgggtcggaaaccggtgcgaaag 12635925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 21898635 - 21898759
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||||||||||||| | ||| | |||||||||||| ||||  |   || |||||| | ||| |||||||||||  ||  |||    
21898635 aaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccttt 21898734  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
21898735 agtgggtcggaaaccggtgcgaaag 21898759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 9633681 - 9633624
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| |||||||||||||||  ||| ||||||||||||||| ||||||||    
9633681 tctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 9633624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 14107414 - 14107357
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| | ||| ||||||||||||||||| || ||||||||||||||| ||||||||    
14107414 tctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaag 14107357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 33859442 - 33859395
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacg 172  Q
    |||||||||| | |||||||||||||||||||| |||||| |||||||    
33859442 aaggacgtactcaggaaataccgggttcgatttttagggggaacaacg 33859395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 3030692 - 3030642
Alignment:
196 acgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||||||||| ||  ||| |||||||||||||||||| |||||    
3030692 acgagtcggattagtcgctcacatttggtgggtcggaaaccgatgtgaaag 3030642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 30788902 - 30788852
Alignment:
196 acgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    ||||| |||||||||||||||  ||| ||||||||||||||| ||||||||    
30788902 acgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 30788852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 29333261 - 29333220
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaa 166  Q
    |||||||||||| || |||||||||||||||||| |||||||    
29333261 aaggacgtacccagggaataccgggttcgatttccaggggaa 29333220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 9179859 - 9179799
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg 185  Q
    |||||||||||| || |||||||||||||||| | ||||| |||||| ||||  |||||||    
9179859 aaggacgtacccagggaataccgggttcgattcccagggggaacaacacttgaccagtatg 9179799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 212
Target Start/End: Complemental strand, 19230680 - 19230592
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcg 212  Q
    |||||||||| |||||| |||||| ||||||||  | ||||| ||||||||||||||||||   || |||||| ||||| |||||||||||    
19230680 aaggacgtactcgggaa-taccggattcgattttcaagggaa-caacgcttggtcagtatgcatgcctctacgcacgagccggattagtcg 19230592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 20)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 5069938 - 5069814
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||||||||||||||||||||||||||| ||| | |||||||||| |  ||| ||   || |||||| || || |||||||||||||||  |||    
5069938 aaggacgtacccgggaaataccgggttcgatttccaggaggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccaccttt 5069839  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||||||||||||    
5069838 ggtgggtcggaaaccgatgcgaaag 5069814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 17748505 - 17748381
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||  |||| |||||||||||||||| | ||||| |||||||||||| ||||  |   || |||||||||||| ||||||||||| |||  |||    
17748505 aaggacgtattcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccaccttt 17748406  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
      |||||||||||||||||||||||    
17748405 gttgggtcggaaaccgatgcgaaag 17748381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 38578990 - 38578866
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||| ||||||||||| | ||||| |||||||||||| ||||  |   || |||||| | ||| |||||||||||||||  |||    
38578990 aaggacgtacccggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 38578891  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
38578890 ggtgggtcggaaaccggtgcgaaag 38578866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 22993490 - 22993366
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||| ||||||||||| | ||| | |||||||||||| |||| ||   || |||||| ||||  |||||||||||| ||  |||    
22993490 aaggacgtacccggggaatatcgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcaccttt 22993391  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||| ||||||||    
22993390 ggtgggtcagaaaccggtgcgaaag 22993366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 18785655 - 18785712
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| ||||||| |||||| ||||| ||||    
18785655 aaggacgtacccggggaataccgggttcgattcctagggggaacaacacttggccagt 18785712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 43925498 - 43925555
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| | ||||| |||||| ||||||||||    
43925498 aaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggtcagt 43925555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 13095844 - 13095968
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||| ||| | ||||| |||||| ||||| ||||  |   || |||||| | ||| |||||||||||| ||  |||    
13095844 aaggacgtacccggggaataccgggttctattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcaccttt 13095943  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||| ||||    
13095944 ggtgggtcggaaaccggtgcaaaag 13095968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 1605927 - 1605984
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||  |||||| ||||||||||| ||||| |||||||||||| ||||    
1605927 aaggacgtacccggagaatacctggttcgatttccagggggaacaacgcttggccagt 1605984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 1797446 - 1797503
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||| | |||||||||||||||| | |||||||||||||||||| ||||    
1797446 aaggacgtatccgaggaataccgggttcgattcccaggggaaacaacgcttggccagt 1797503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 26423410 - 26423353
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||  | |||||||||||||||| | |||||||||||||||||| ||||    
26423410 aaggacgtacccaaggaataccgggttcgattcccaggggaaacaacgcttggccagt 26423353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 43346835 - 43346778
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||| |||||||||||| ||| ||| ||||||||||||||  ||||||||    
43346835 tctacgtacgagccggattagtcgctcatctttggtgggtcggaaaccagtgcgaaag 43346778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 236
Target Start/End: Original strand, 23658165 - 23658279
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||||| || |||| |  |||||||||| ||||| |||||||||||| |||| ||   || |||||  ||||| ||||||||||| |||| |||    
23658165 aaggacgtacccagggaatatccagttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatcttt 23658264  T
222 tgtgggtcggaaacc 236  Q
     ||||||| ||||||    
23658265 ggtgggtcagaaacc 23658279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 177
Target Start/End: Original strand, 45447956 - 45448008
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    ||||||||||||| |||||||| ||||||||||| ||||  ||||||||||||    
45447956 aaggacgtacccgagaaataccaggttcgatttccagggagaacaacgcttgg 45448008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 22973953 - 22974077
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||| |||| ||||||||||||||||   ||||| |||||||||||| |||| ||   || |||||| | ||| | ||||||||| |||  |||    
22973953 aaggacgtactcggggaataccgggttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccaccttt 22974052  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| |||||||  |||||||    
22974053 ggtgggtcagaaaccggcgcgaaag 22974077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 129 - 246
Target Start/End: Original strand, 27028269 - 27028389
Alignment:
129 acgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtg 225  Q
    ||||||| |||||||||| ||||||||||| ||||| |||||| ||||| ||||  |   || |||||  | |||  ||||||||||| ||  ||| |||    
27028269 acgtacctgggaaataccaggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtg 27028368  T
226 ggtcggaaaccgatgcgaaag 246  Q
    |||||||||||| ||||||||    
27028369 ggtcggaaaccggtgcgaaag 27028389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 10047999 - 10047942
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||| | ||||| |||||| ||||| ||||    
10047999 aaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagt 10047942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 182
Target Start/End: Complemental strand, 10317864 - 10317811
Alignment:
129 acgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||| |||||||||||||||| | ||||| || ||| ||||||||||    
10317864 acgtacccggggaataccgggttcgattcccagggggaataacacttggtcagt 10317811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 47341862 - 47341919
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| ||||||| |||||||| | ||||| |||||| ||||| ||||    
47341862 aaggacgtacccggggaataccgagttcgattcccagggggaacaacacttggccagt 47341919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 173
Target Start/End: Complemental strand, 34127743 - 34127695
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgc 173  Q
    ||||||||||||||| |||||||||||||||| | ||| | ||||||||    
34127743 aaggacgtacccggggaataccgggttcgattccgaggaggaacaacgc 34127695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 142 - 182
Target Start/End: Original strand, 39474943 - 39474983
Alignment:
142 ataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| ||| ||| |||||||||||||||||    
39474943 ataccgggttcgattcctatggggaacaacgcttggtcagt 39474983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 27)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 133 - 246
Target Start/End: Complemental strand, 28572327 - 28572211
Alignment:
133 acccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggtc 229  Q
    ||||||| ||||| |||||||||| | |||||||||||||||||| |||||||   || |||||| ||||| |||||||||||||||  ||| |||||||    
28572327 acccggggaatactgggttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtc 28572228  T
230 ggaaaccgatgcgaaag 246  Q
    |||||||| ||||||||    
28572227 ggaaaccggtgcgaaag 28572211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 15320169 - 15320293
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||||| ||| | ||||| | |||| |||| ||   || |||||| ||||| |||||||||||||||  |||    
15320169 aaggacgtacccggggaataccgggttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccaccttt 15320268  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||| ||||||||    
15320269 ggtgggtcagaaaccggtgcgaaag 15320293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 29127902 - 29128026
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| | ||| |||| ||||||||||||| ||||  |||||| ||||||||||  |   || |||||| | ||| |||||||||||||||  |||    
29127902 aaggacgtatctggggaatatcgggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 29128001  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||||||||||||    
29128002 ggtgggtcggaaaccgatgcgaaag 29128026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 35315939 - 35316063
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||  |||| ||||||||||| | ||||| |||||| ||||| ||||  |   || |||||| | |||  |||||||||||||| ||||    
35315939 aaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccactttt 35316038  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||||||||||||    
35316039 ggtgggtcggaaaccgatgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 7328827 - 7328950
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccatttt 220  Q
    |||||||||||||||||||||||||||||||| | ||||| |||||| ||||| ||||    ||| ||  |||| | ||| |||||||||||||||  ||    
7328827 aaggacgtacccgggaaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcct--tacgcatgagccggattagtcgcccacctt 7328924  T
221 ttgtgggtcggaaaccgatgcgaaag 246  Q
    | |||||||| |||||| ||||||||    
7328925 tggtgggtcgaaaaccggtgcgaaag 7328950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 243
Target Start/End: Complemental strand, 26207925 - 26207804
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||| ||||||||| |||||||||||||||| | | ||| |||||||||||  |||| ||   || |||||| | ||| ||||||||||| ||||| ||    
26207925 aaggatgtacccggggaataccgggttcgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggattagtcggccattatt 26207826  T
222 tgtgggtcggaaaccgatgcga 243  Q
     ||||||||||||||| |||||    
26207825 agtgggtcggaaaccggtgcga 26207804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 235
Target Start/End: Complemental strand, 30767371 - 30767258
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||| ||||| ||| |||| ||||||||||||| ||||| |||||| ||||| |||| ||   || |||||| ||||| |||||||||||||||  |||    
30767371 aaggatgtacctggggaatatcgggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgcccaccttt 30767272  T
222 tgtgggtcggaaac 235  Q
     |||||||||||||    
30767271 ggtgggtcggaaac 30767258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 141 - 246
Target Start/End: Original strand, 7650226 - 7650334
Alignment:
141 aataccgggttcgatttctaggggaaacaacgcttggtcagtatggct---tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccg 237  Q
    |||||||||||||||||| ||||| |||||| ||||| ||||| |  |   |||||| ||||| |||||||||||||||  ||| |||||| ||||||||    
7650226 aataccgggttcgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggttggaaaccg 7650325  T
238 atgcgaaag 246  Q
     ||||||||    
7650326 gtgcgaaag 7650334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 47749228 - 47749105
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| || || |||||||||||||||| ||||||||| |||| ||||| ||||  |   || |||||| ||||| || ||||||||||||  |||    
47749228 aaggacgtatccagggaataccgggttcgattcctaggggaa-caactcttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccaccttt 47749130  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     || |||||||||||||||||||||    
47749129 ggtaggtcggaaaccgatgcgaaag 47749105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 54261209 - 54261333
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||| ||| |||||||||||||||| ||||| | |||||||||||| ||||  |   || |||||| | ||| |||||||||||  ||  |||    
54261209 aaggacgtacctggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccttt 54261308  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
54261309 agtgggtcggaaaccggtgcgaaag 54261333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 7310760 - 7310703
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| |||||||||||| ||| ||| ||||||||||||||||||||||||    
7310760 tctacgcacgagccggattagtcgctcatctttggtgggtcggaaaccgatgcgaaag 7310703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 31072861 - 31072918
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||  |||||| ||||||||||| ||||| |||||||||||||||||    
31072861 aaggacgtacccggagaataccaggttcgatttccagggggaacaacgcttggtcagt 31072918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 45877437 - 45877494
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||||| |||||||||||| ||||| ||||    
45877437 aaggacgtatccggggaataccgggttcgatttccaggggaaacaacacttggccagt 45877494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 13893909 - 13894033
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||  ||||| ||||||||||| |||||| ||||| ||||||||||||||| |  |   || |||||  ||||| |||||||||||||||  |||    
13893909 aaggacgtgtccggggaataccgggttggatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccaccttt 13894008  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||| ||| |||||| ||||||||    
13894009 ggtggatcgaaaaccggtgcgaaag 13894033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 245
Target Start/End: Complemental strand, 3507657 - 3507534
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||| | || ||||||||||| |||| |||| || |||||| ||||| ||||  |   || |||||| ||||| |||||||||||| ||  |||    
3507657 aaggacgtacacagggaataccgggtttgattcctagagggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcaccttt 3507558  T
222 tgtgggtcggaaaccgatgcgaaa 245  Q
     ||||||||||||||| |||||||    
3507557 ggtgggtcggaaaccggtgcgaaa 3507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 15795617 - 15795561
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| ||||||| |||||||| | ||||| |||||||||||||||||    
15795617 aaggacgtacccggggaataccgagttcgattcccagggg-aacaacgcttggtcagt 15795561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 246
Target Start/End: Complemental strand, 36043730 - 36043674
Alignment:
190 ctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    ||||| ||||| |||||||||||||||  ||| ||||||||||||||| ||||||||    
36043730 ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 36043674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 177
Target Start/End: Original strand, 48342003 - 48342055
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    ||||||||||| ||| |||||||||||| ||| ||||||| ||||||||||||    
48342003 aaggacgtacctggggaataccgggttctattcctagggggaacaacgcttgg 48342055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 147 - 237
Target Start/End: Complemental strand, 50405705 - 50405612
Alignment:
147 gggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccg 237  Q
    |||||||||| | |||||||||||||||||  ||||  |   || |||||| |||||||||||||||||||||   || |||||||||||||||    
50405705 gggttcgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccg 50405612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 183
Target Start/End: Original strand, 10855379 - 10855425
Alignment:
137 gggaaataccgggttcgatttctaggggaaacaacgcttggtcagta 183  Q
    ||||||||||||||| |||||| ||||| |||||||||||| |||||    
10855379 gggaaataccgggtttgatttccagggggaacaacgcttggccagta 10855425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 235
Target Start/End: Original strand, 19873422 - 19873468
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaac 235  Q
    |||||| ||||| ||||||||||| |||| |||||||||||||||||    
19873422 tctacgcacgagccggattagtcgtccatcttttgtgggtcggaaac 19873468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 47219127 - 47219251
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||| ||||||||| | | ||||||||||||||||  |||  |   || |||||| | ||| ||||||||||| |||  |||    
47219127 aaggacgtatccggggaataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtccaccttt 47219226  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
      |||||||||||||| ||||||||    
47219227 gatgggtcggaaaccggtgcgaaag 47219251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 47471815 - 47471938
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||||  || |||||||||||||||| | ||||||| ||| ||||||  |||  |   ||||||||| | ||| || |||||||| |||  |||    
47471815 aaggacgtacctagggaataccgggttcgattcccaggggaa-caatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccaccttt 47471913  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||||||||||||    
47471914 ggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 30045820 - 30045861
Alignment:
141 aataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||||||||||||| ||||||| |||||||||||| ||||    
30045820 aataccgggttcgattcctagggggaacaacgcttggccagt 30045861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 49198334 - 49198391
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||| || ||||| |||||||||||||||| ||||||| |||||| ||||| ||||    
49198334 aaggacatatccggggaataccgggttcgattcctagggggaacaacacttggccagt 49198391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 7613050 - 7612998
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    ||||||||||  ||| |||||||||||||||| | ||||| ||||||||||||    
7613050 aaggacgtacttggggaataccgggttcgattcccagggggaacaacgcttgg 7612998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 42412898 - 42412846
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    ||||||||| ||||| |||||||||||||||| |  |||| ||||||||||||    
42412898 aaggacgtatccggggaataccgggttcgattcccggggggaacaacgcttgg 42412846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 30)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 10823043 - 10823167
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| ||||||||||| |||| | ||| | |||||||||||| ||||  |   || |||||| ||||| |||||||||||||||  |||    
10823043 aaggacgtacccggggaataccgggtttgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttt 10823142  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||||||| ||||||||    
10823143 tgtgggtcggaaaccggtgcgaaag 10823167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 126 - 237
Target Start/End: Original strand, 7787040 - 7787154
Alignment:
126 aggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccatttttt 222  Q
    |||||||||||||| |||||||||||||||||| ||||| |||||  ||||| ||||| |   || |||||| ||||| |||||||||||||||| |||     
7787040 aggacgtacccggggaataccgggttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttg 7787139  T
223 gtgggtcggaaaccg 237  Q
    |||| ||| ||||||    
7787140 gtggatcgaaaaccg 7787154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 246
Target Start/End: Original strand, 12455300 - 12455417
Alignment:
132 tacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggt 228  Q
    |||||||| |||||||||||||||||| |||||||||||||||| | ||||  |   || |||||| ||||| |||||||||||| ||   || ||||||    
12455300 tacccggggaataccgggttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggt 12455399  T
229 cggaaaccgatgcgaaag 246  Q
    ||||||||| ||||||||    
12455400 cggaaaccggtgcgaaag 12455417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 8410114 - 8410238
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||  |||| ||||||||||| | ||||| |||||| ||||| ||||  |   || |||||| ||||| ||||||||||||||| ||||    
8410114 aaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccactttt 8410213  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     | ||||||||||||| ||||||||    
8410214 ggggggtcggaaaccggtgcgaaag 8410238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 9360871 - 9360747
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||| ||||||||| |||| |||||||||| |||| ||||  |   || |||||| ||||| || ||||||||||||  |||    
9360871 aaggacgtacccggggaataccaggttcgattactagaggaaacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccaccttt 9360772  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||| ||||||||| ||||||||    
9360771 agtgggccggaaaccggtgcgaaag 9360747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 25540527 - 25540403
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| | ||| ||||| |||||||||| ||||||| |||||||||||| ||||  |   || |||||| ||||| ||||||||||| |||  |||    
25540527 aaggacgtatctggggaatactgggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccttt 25540428  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
25540427 ggtgggtcggaaaccggtgcgaaag 25540403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 125 - 236
Target Start/End: Original strand, 331484 - 331598
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||||| |||||| ||||| ||||  |   ||||||||| | ||| |||||||||||||||  |||    
331484 aaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccaccttt 331583  T
222 tgtgggtcggaaacc 236  Q
     |||||| |||||||    
331584 ggtgggttggaaacc 331598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 7747257 - 7747381
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||||||||||||| ||||| | ||||||| |||| |||| ||   || |||||| | ||| |||||||||||  ||  |||    
7747257 aaggacgtatccggggaataccgggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcaccttt 7747356  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
7747357 agtgggtcggaaaccggtgcgaaag 7747381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 15079466 - 15079517
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttg 176  Q
    ||||||||||||||| ||||| |||||||||||| ||||| |||||||||||    
15079466 aaggacgtacccggggaatacagggttcgatttccagggggaacaacgcttg 15079517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 18902653 - 18902529
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatggct---tctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||| |||| |||||||||||||||| | | ||| |||||||||||  ||||  |  |   |||||| ||||| | |||||||||||||  |||    
18902653 aaggacgtactcggggaataccgggttcgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccaccttt 18902554  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
18902553 ggtgggtcggaaaccggtgcgaaag 18902529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 41032028 - 41031905
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||| |||||  ||||||||||||| | ||||| |||||| ||||| |||| ||   || |||||| ||||| |||||||||| ||||  |||    
41032028 aaggacgtaccagggaac-accgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcacccaccttt 41031930  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||  ||||||||    
41031929 ggtgggtcggaaaccagtgcgaaag 41031905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 41220618 - 41220742
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||| | |||||||||||| ||||  |   || |||||| | ||| || ||||||||  ||  |||    
41220618 aaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcaccttt 41220717  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
41220718 agtgggtcggaaaccggtgcgaaag 41220742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 141 - 245
Target Start/End: Complemental strand, 16636172 - 16636065
Alignment:
141 aataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccg 237  Q
    |||| |||||||||||| ||| ||||||||| |||| ||||| ||   ||||||||| |||||  |||||||||   ||||||| |||| | ||||||||    
16636172 aatatcgggttcgatttttagaggaaacaacacttgatcagtgtgcatgcttctacgcacgagatggattagtcattcatttttggtggattggaaaccg 16636073  T
238 atgcgaaa 245  Q
    ||||||||    
16636072 atgcgaaa 16636065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 29653610 - 29653667
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||||||| | ||||||||||| ||||||||| |||| ||||||||||||| ||||    
29653610 aaggacgtactccggaaataccggattcgatttccagggaaaacaacgcttgggcagt 29653667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 34356189 - 34356246
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| | ||| |||||||||||||||||| ||||| |||||| ||||||||||    
34356189 aaggacgtatctggggaataccgggttcgatttccagggggaacaacacttggtcagt 34356246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 21286427 - 21286478
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttg 176  Q
    ||||||||| ||||| |||||||||||||||| | ||| |||||||||||||    
21286427 aaggacgtatccggggaataccgggttcgattcccaggcgaaacaacgcttg 21286478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 2528464 - 2528340
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||| || | || ||||||||||||| | ||||| ||||||||||||||||| ||   || |||||  |  || |||||||||||| ||| |||    
2528464 aaggacgtactcgaggaacaccgggttcgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctcatcttt 2528365  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||| ||||||||| | ||||||||    
2528364 agtgagtcggaaactggtgcgaaag 2528340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 3644010 - 3643886
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| ||||||||||| |||||||| | | |||||||||||| ||||  |   || |||||| | |||  |||||||||| |||  |||    
3644010 aaggacgtatccggggaataccgggtttgatttctacgaggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccaccttt 3643911  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||| ||||||||| ||||||||    
3643910 ggtgggccggaaaccgttgcgaaag 3643886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 11069861 - 11069985
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||| ||||||||| | ||||| ||||||| |||| ||||  |    | |||||| |||||  | |||||||| |||   ||    
11069861 aaggacgtacccggggaataccaggttcgattccgagggggaacaacgtttggccagtgcgcatacctctacgcacgagctgaattagtcgtccaccgtt 11069960  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||||||||||||    
11069961 ggtgggtcggaaaccgatgcgaaag 11069985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 38005385 - 38005509
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| ||||| |||||||||| | | ||| |||||||||||| ||||  |   || |||||  | ||| |||||||||||||||  |||    
38005385 aaggacgtacccggggaatactgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccaccttt 38005484  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||| |||||||| | ||||||||    
38005485 ggtggatcggaaactggtgcgaaag 38005509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 18649082 - 18649025
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| | |||||||||||||||| || |||| |||||| |||||||| ||||||||    
18649082 tctacgcatgagtcggattagtcgctcacttttggtgggttggaaaccgttgcgaaag 18649025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 19976930 - 19976873
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||||  ||||| || |||| |||||||||    
19976930 aaggacgtatccggggaataccgggttcgattttcagggggaataacgtttggtcagt 19976873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 28616435 - 28616378
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| | |||||||||||||| ||| ||||||| ||||||| ||||||||    
28616435 tctacgcacgagccagattagtcgcccatctttagtgggtcagaaaccggtgcgaaag 28616378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 38962746 - 38962803
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||||  ||| | |||||||||||| ||||    
38962746 aaggacgtatccggggaataccgggttcgattttcaggaggaacaacgcttggccagt 38962803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 39807008 - 39806951
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| | | | ||||||||| |||| ||||    
39807008 aaggacgtacccggggaataccgggttcgattcccaagagaaacaacgtttggccagt 39806951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 182
Target Start/End: Complemental strand, 40969022 - 40968981
Alignment:
141 aataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||||||||||||||| |||| |||||||| |||||||||    
40969022 aataccgggttcgatttccagggaaaacaacgtttggtcagt 40968981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 44945643 - 44945700
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| |||||||||||||||  ||| |||| |||||||||| ||||||||    
44945643 tctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaag 44945700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 202 - 246
Target Start/End: Original strand, 792217 - 792261
Alignment:
202 cggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||||||| ||| ||||||||||||||| ||| ||||    
792217 cggattagtcgcccatctttggtgggtcggaaaccggtgcaaaag 792261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 177
Target Start/End: Original strand, 29422198 - 29422250
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    ||||||||||||||| ||||| |||||||||||| || || |||||| |||||    
29422198 aaggacgtacccggggaatactgggttcgatttccagagggaacaacacttgg 29422250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 245
Target Start/End: Complemental strand, 29482336 - 29482280
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaa 245  Q
    ||||| |||||||||||||||| | ||||||||| ||||| | |||||| |||||||    
29482336 tctacatacgagtcggattagttgtccattttttatgggttgaaaaccggtgcgaaa 29482280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 22)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 8513503 - 8513627
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccatttt 220  Q
    ||||||||||||||| |||||||||||||||| ||||||||||||| |||||| ||||    || || |||||| ||||| | ||||||||| |||  ||    
8513503 aaggacgtacccggggaataccgggttcgattcctaggggaaacaatgcttggccagtgcacat-gcctctacgcacgagccagattagtcgtccacctt 8513601  T
221 ttgtgggtcggaaaccgatgcgaaag 246  Q
    | ||||||||||||||| ||||||||    
8513602 tggtgggtcggaaaccggtgcgaaag 8513627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 9812856 - 9812980
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||| | |||||||||||| |||| ||   ||||||||| | ||  |||||||||||||||  |||    
9812856 aaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccaccttt 9812955  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||| ||||||||    
9812956 ggtgggtcagaaaccggtgcgaaag 9812980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 12704998 - 12705122
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||| | |||||||||||  |||| ||   ||||||||| | ||  |||||||||||||||  |||    
12704998 aaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccaccttt 12705097  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||| ||||||||    
12705098 ggtgggtcagaaaccggtgcgaaag 12705122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 5732043 - 5731919
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||| | |||||||||||| ||||  |   || |||||||| ||| | |||||||||  ||  |||    
5732043 aaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcaccttt 5731944  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
5731943 agtgggtcggaaaccggtgcgaaag 5731919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 183
Target Start/End: Original strand, 20692917 - 20692975
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagta 183  Q
    ||||||||||||||| ||||||||||| |||| |||| ||||||||||||||| |||||    
20692917 aaggacgtacccggggaataccgggtttgattcctagaggaaacaacgcttggccagta 20692975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 42086311 - 42086435
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||| | |||||||||||||||| | ||||| |||||||||||  ||||  |   || |||||| | ||| ||||||||||| |||  |||    
42086311 aaggacgtacccgaggaataccgggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaccttt 42086410  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
42086411 ggtgggtcggaaaccggtgcgaaag 42086435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 7866565 - 7866689
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||| | |||||||||||||||| | ||| | |||||||||||| |||| ||   || |||||| ||||  |||||||||||||||  |||    
7866565 aaggacgtacccgaggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccaccttt 7866664  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||  ||||||  ||||||||    
7866665 ggtgggttagaaaccagtgcgaaag 7866689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 20682740 - 20682616
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| ||||  ||||| |||||| ||||| |||||||||||| ||||  |   || |||||| ||||| ||||||| ||| |||  |||    
20682740 aaggacgtacccggggaatattgggttagatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccaccttt 20682641  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||| |||||||| ||||||||    
20682640 agtgggttggaaaccggtgcgaaag 20682616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 1898985 - 1899042
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||| ||||||||| |||||||||||||||| | ||||| |||||||||||| ||||    
1898985 aaggatgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagt 1899042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 2485247 - 2485304
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||| |||||||||||||||| ||  |||  |||||||||||||||||||||||    
2485247 tctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 2485304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 11845924 - 11845867
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||| |||||| ||||||||||||| ||||| ||||||| |||| ||||    
11845924 aaggacgtacccgagaaatatcgggttcgatttcgagggggaacaacgtttggccagt 11845867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 15034059 - 15034116
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||| ||||||||| |||||||||||| ||||| | |||||||||| ||||||||||    
15034059 aaggatgtacccggggaataccgggttcaatttccatgggaaacaacacttggtcagt 15034116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 25417306 - 25417249
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||||||| |||| |||||||||||||||| | ||||| |||||||||||| ||||    
25417306 aaggacgtactcggggaataccgggttcgattcccagggggaacaacgcttggccagt 25417249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 27648481 - 27648424
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||| ||| ||||||||||| |||| ||| |||| |||||||||||||||||||    
27648481 tctacgtatgagccggattagtcgtccatctttggtggatcggaaaccgatgcgaaag 27648424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 35403635 - 35403583
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    |||||||||| |||||||||||||||||||||   ||||| ||||||||||||    
35403635 aaggacgtactcgggaaataccgggttcgattctaagggggaacaacgcttgg 35403583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 125 - 176
Target Start/End: Complemental strand, 35813121 - 35813070
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttg 176  Q
    ||||||||||||| | |||||||||||||||| |||||||||| || |||||    
35813121 aaggacgtacccgaggaataccgggttcgattcctaggggaaataatgcttg 35813070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 196 - 246
Target Start/End: Complemental strand, 38296779 - 38296729
Alignment:
196 acgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||||||||||||  |||  |||||||||||||||||| ||||    
38296779 acgagtcggattagtcgcccacctttgatgggtcggaaaccgatgcaaaag 38296729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 6767174 - 6767133
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaa 166  Q
    ||||||||||||||| ||||||||||||||||  ||||||||    
6767174 aaggacgtacccggggaataccgggttcgattcataggggaa 6767133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 28857112 - 28857169
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||| ||||||| |||||||||||||||| | ||||| |||||| ||||| ||||    
28857112 aaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggccagt 28857169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 170
Target Start/End: Original strand, 30349563 - 30349608
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaa 170  Q
    ||||||||| ||||| ||||||||||| |||||||||||| |||||    
30349563 aaggacgtatccggggaataccgggtttgatttctagggggaacaa 30349608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 40773324 - 40773381
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    ||||| ||||||||||||||||||  ||| ||| ||| ||||||||||| ||||||||    
40773324 tctacatacgagtcggattagtcgttcatctttggtgcgtcggaaaccggtgcgaaag 40773381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 23247474 - 23247414
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg 185  Q
    ||||||||||| ||| |||| ||||||||||| | ||| | ||||||||||| ||||||||    
23247474 aaggacgtacctggggaatatcgggttcgattcccaggaggaacaacgcttgatcagtatg 23247414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 9e-18; HSPs: 21)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 10927593 - 10927717
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| ||||| | |||||||||||| ||||  |   || |||||| | ||| |||||||||||  ||  |||    
10927593 aaggacgtacccggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccttt 10927692  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||||||||||||    
10927693 agtgggtcggaaaccgatgcgaaag 10927717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 17981428 - 17981552
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||| |||||||||||||||||||||||||| | ||||| |||||| ||||  |||| ||   || |||||| |||||||| |||||| |||||  |||    
17981428 aaggatgtacccgggaaataccgggttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgcacgagtcgaattagttgcccagcttt 17981527  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||| ||||||||||| ||||||||    
17981528 ggtgagtcggaaaccggtgcgaaag 17981552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 8141089 - 8141213
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||  |||| |||||||||||||||||| |||||||||||||||||| ||||  |   || |||||| | |||  | |||||||| |||  |||    
8141089 aaggacgtattcggggaataccgggttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacattt 8141188  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||||||||||||    
8141189 ggtgggtcagaaaccgatgcgaaag 8141213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 44893401 - 44893277
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||| ||||||||||| ||||| |||||| |||| ||   || |||||| ||||| ||||||| |||| ||   ||    
44893401 aaggacgtacccggggaataccgggttcaatttctagggggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcaccctt 44893302  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
      |||||||||||||| ||| ||||    
44893301 gatgggtcggaaaccggtgcaaaag 44893277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 245
Target Start/End: Complemental strand, 15884678 - 15884556
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||| ||| |||||||||||||||| | ||||||| |||| |||||  |||  |   || |||||| ||||| |||||||||||||||  |||    
15884678 aaggacgtacctggggaataccgggttcgattcccaggggaa-caacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccaccttt 15884580  T
222 tgtgggtcggaaaccgatgcgaaa 245  Q
     ||||||||||||||| |||||||    
15884579 ggtgggtcggaaaccggtgcgaaa 15884556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 183
Target Start/End: Complemental strand, 1013100 - 1013042
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagta 183  Q
    ||||||||| ||||| |||||||||||||||| | ||||| |||||||||||| |||||    
1013100 aaggacgtatccggggaataccgggttcgattcccagggggaacaacgcttggccagta 1013042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 14666194 - 14666070
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||||||||||||| | |||||||||||| ||||| ||||  |   || |||||| || || | |||||||||||||   ||    
14666194 aaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagtt 14666095  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||||| |||||| ||||||||    
14666094 ggtgggtcgaaaaccggtgcgaaag 14666070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 33401922 - 33401799
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||| |||| |||||||||||||||||  ||||| |||||| ||||  |||| ||   || |||||| | |||||||||||||||||||  |||    
33401922 aaggacgtactcggggaataccgggttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcggattagtcgcccaccttt 33401823  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||| ||  |||||||||||||||    
33401822 agtggatc-aaaaccgatgcgaaag 33401799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 2467241 - 2467184
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||||| ||||| |||||| ||||| ||||    
2467241 aaggacgtatccggggaataccgggttcgatttccagggggaacaactcttggccagt 2467184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 8803108 - 8803165
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| ||||||||||||||||   | ||||||||||||||||||||||||    
8803108 tctacgcacgagccggattagtcgcccatcaatggtgggtcggaaaccgatgcgaaag 8803165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 38922537 - 38922480
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| | || || |||||||||||| ||||    
38922537 aaggacgtacccggggaataccgggttcgattcccagagggaacaacgcttggccagt 38922480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 44031563 - 44031506
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||| ||| |||||||||| ||||||||||||| ||||| |||||||||||| ||||    
44031563 aaggatgtaaccgggaaatatcgggttcgatttccagggggaacaacgcttggccagt 44031506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 137 - 246
Target Start/End: Original strand, 26570923 - 26571035
Alignment:
137 gggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggtcggaa 233  Q
    |||||||| ||||||| ||| ||||||| |||||||||||| |||| ||   || |||||| | ||| ||||||||||| |||  |||  || |||||||    
26570923 gggaaatatcgggttcaattcctagggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcgtccacctttgatgagtcggaa 26571022  T
234 accgatgcgaaag 246  Q
    ||||||| |||||    
26571023 accgatgtgaaag 26571035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 216
Target Start/End: Original strand, 583801 - 583893
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgccca 216  Q
    |||||||||| || |||||||||||||||||| ||||||  |||||||||||  ||||  |   || |||||| | |||||||||||||||||||    
583801 aaggacgtactcgagaaataccgggttcgattcctaggg--aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgccca 583893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 1653904 - 1653859
Alignment:
201 tcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||| ||||| || ||||||||||||||| ||||||||    
1653904 tcggattagtcgtccattattggtgggtcggaaaccggtgcgaaag 1653859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 1742280 - 1742235
Alignment:
201 tcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||| ||||| || ||||||||||||||| ||||||||    
1742280 tcggattagtcgtccattattggtgggtcggaaaccggtgcgaaag 1742235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 6100459 - 6100516
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||| | ||| | |||||||||||| ||||    
6100459 aaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagt 6100516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 22276603 - 22276546
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||||||||| | ||||||||||||| ||| ||||| | |||||| ||||||||||    
22276603 aaggacgtacccagaaaataccgggttctattcctaggaggaacaacacttggtcagt 22276546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 43027359 - 43027416
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| | ||| ||||||||||| |||| |||  |||||||||||||||||||||||    
43027359 tctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaaag 43027416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 34710690 - 34710638
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    |||||||||| ||| ||||||||| ||||||| | |||||||||||| |||||    
34710690 aaggacgtactcggaaaataccggattcgattcccaggggaaacaacacttgg 34710638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 34846801 - 34846860
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg 185  Q
    ||||||||||||||||| |||||||||||||| | | ||  |||||||||||| |||||||    
34846801 aaggacgtacccgggaa-taccgggttcgattcccatggtgaacaacgcttggccagtatg 34846860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 9e-18; HSPs: 27)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 7246769 - 7246645
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| ||||| |||||||||| |||| || |||||||||||| ||||  |   || |||||| | ||| |||||||||||||||  |||    
7246769 aaggacgtacccggggaatactgggttcgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccaccttt 7246670  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
7246669 ggtgggtcggaaaccggtgcgaaag 7246645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 38166015 - 38166139
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccatttt 220  Q
    ||||||||| ||||| ||||| ||||| |||| | ||||| |||||||||||| ||||    |||||| ||||| ||||| |||||||||||||||  ||    
38166015 aaggacgtatccggggaatactgggttggattcccagggggaacaacgcttggccagtgcgcatggct-ctacgcacgagccggattagtcgcccacctt 38166113  T
221 ttgtgggtcggaaaccgatgcgaaag 246  Q
    | ||||||||||||||| ||||||||    
38166114 tggtgggtcggaaaccggtgcgaaag 38166139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 125 - 243
Target Start/End: Complemental strand, 1940897 - 1940779
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgctt-ggtcagtatggcttctacgtacgagtcggattagtcgcccattttttg 223  Q
    |||||||||||||||||||| ||||||||||| | ||||| |||||||||| |||  | || || |||||| ||||| |||||||||||||||  ||| |    
1940897 aaggacgtacccgggaaatatcgggttcgattcccagggggaacaacgcttgggtgcgcat-gcctctacgcacgagccggattagtcgcccacctttgg 1940799  T
224 tgggtcggaaaccgatgcga 243  Q
    ||||||| |||||| |||||    
1940798 tgggtcgaaaaccggtgcga 1940779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 55921022 - 55921146
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||| ||||||| |||||||||||||||| | ||||| |||||| ||||||||||  |   || |||||||| ||| ||||||| |||| ||  |||    
55921022 aaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcaccttt 55921121  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
55921122 ggtgggtcggaaaccggtgcgaaag 55921146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 36145338 - 36145281
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| | ||||||||||||||||| |||||    
36145338 aaggacgtacccggggaataccgggttcgattcccaggggaaacaacgcttgatcagt 36145281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 36262888 - 36262766
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccatttt 220  Q
    ||||||||||||||  |||||||||||||||| | ||||  |||||||||||| ||||    ||| || ||||| |||||||||||||||||||||  ||    
36262888 aaggacgtacccggagaataccgggttcgattcccaggg--aacaacgcttggccagtgcacatgcct-ctacgcacgagtcggattagtcgcccacctt 36262792  T
221 ttgtgggtcggaaaccgatgcgaaag 246  Q
    | ||||||| |||||| |||||||||    
36262791 tggtgggtcagaaaccaatgcgaaag 36262766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 47078446 - 47078570
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccatttt 220  Q
    ||||||||||||||| |||||||||||||||| | ||||| |||||||||||| ||||    || || |||||| ||||| |||||||||||| ||   |    
47078446 aaggacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacat-gcctctacgcacgagccggattagtcgctcaccat 47078544  T
221 ttgtgggtcggaaaccgatgcgaaag 246  Q
    | ||||||||||||||  ||||||||    
47078545 tggtgggtcggaaaccagtgcgaaag 47078570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 237
Target Start/End: Original strand, 8889010 - 8889125
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccatttt 220  Q
    ||||||||| ||||| |||||||||||||||| ||||||| |||||| ||||| ||||    ||||| |||||| | ||| ||||||||||| |||  ||    
8889010 aaggacgtatccggggaataccgggttcgattcctagggggaacaacacttgggcagtgcgcatggc-tctacgcatgagccggattagtcgtccacctt 8889108  T
221 ttgtgggtcggaaaccg 237  Q
    | |||||||||||||||    
8889109 tggtgggtcggaaaccg 8889125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 2559295 - 2559419
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||| ||| |||||||| ||||||||||||| | |||||||||||| ||||  |   || |||||| || || ||||||| ||| |||  |||    
2559295 aaggacgtacctggggaataccggattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccaccttt 2559394  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
2559395 ggtgggtcggaaaccggtgcgaaag 2559419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 30317221 - 30317345
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||| |||| |||| | |||||||||   || || |||||||||||| ||||| |   || |||||| ||||| || ||||||||||||  |||    
30317221 aaggacgtactcggggaatatcaggttcgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccaccttt 30317320  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||||||||||||||| |||||    
30317321 ggtgggtcggaaaccgatgtgaaag 30317345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 42722700 - 42722576
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||||||||||||||||||||| ||| | ||| | |||||||||||| ||||  |   || |||||| | ||| |||||||||||  ||  |||    
42722700 aaggacgtacccgggaaataccgggttcaattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccttt 42722601  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||||| |||||| ||||||||    
42722600 agtgggtcgaaaaccggtgcgaaag 42722576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 128 - 177
Target Start/End: Original strand, 29588727 - 29588776
Alignment:
128 gacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttgg 177  Q
    ||||| ||||||||||||||||||||||| | ||||||||||| ||||||    
29588727 gacgtgcccgggaaataccgggttcgattcccaggggaaacaaagcttgg 29588776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 129 - 182
Target Start/End: Original strand, 43468339 - 43468392
Alignment:
129 acgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||| |||||||||||||||| | ||||| |||||||||||| ||||    
43468339 acgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagt 43468392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 216
Target Start/End: Complemental strand, 41339518 - 41339424
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgccca 216  Q
    ||||||||||||||  |||||||||||||| | | | ||| |||||||||||| |||| ||   || |||||| ||||| |||||||||||||||    
41339518 aaggacgtacccggagaataccgggttcgactcccaaggggaacaacgcttggccagtgtgtatgcctctacgcacgagacggattagtcgccca 41339424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 3159592 - 3159468
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||  |||||||||||||| ||| ||||| |||||||||||| ||||  |   || |||||| ||||| | |||||||||| ||   ||    
3159592 aaggacgtatccggagaataccgggttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccatt 3159493  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||| ||||    
3159492 ggtgggtcggaaaccggtgcaaaag 3159468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 29895775 - 29895899
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||||||||||||| | ||||| |||||| ||||| ||||  |   || |||||| | ||| ||||||||||| |||   ||    
29895775 aaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccatt 29895874  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||| |||||||||| ||||||||    
29895875 ggtggttcggaaaccggtgcgaaag 29895899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 38168245 - 38168368
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt---atggcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||| ||||||||| ||| | | |||||||||||| ||||   || || |||||| | ||| |||||||||||  ||  |||    
38168245 aaggacgtacccggggaataccaggttcgattcctaagaggaacaacgcttggccagtgccat-gcctctacgcatgagccggattagtcgttcaccttt 38168343  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||| |||||||| ||||||||    
38168344 agtgggttggaaaccggtgcgaaag 38168368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 1446814 - 1446871
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||| | ||||| |||||| ||||| ||||    
1446814 aaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagt 1446871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 10541020 - 10541061
Alignment:
141 aataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||| ||||||||||||| |||||||||||||||||| ||||    
10541020 aatatcgggttcgatttccaggggaaacaacgcttggccagt 10541061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 31588741 - 31588798
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| | ||| |||||||||||| || |||| |||| |||||||||||||||||||    
31588741 tctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag 31588798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 37369098 - 37369041
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||||||||| ||||||||| | || |||  |||||||||||||||||||    
37369098 tctacgcacgagtcggataagtcgcccactattggtgaatcggaaaccgatgcgaaag 37369041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 41163005 - 41162948
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||||||||||| |||||||||| || || |||||| ||||| ||||    
41163005 aaggacgtatccgggaaataccgagttcgatttccagagggaacaacacttggccagt 41162948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 47682438 - 47682381
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| ||| |||||||||||  ||| ||||||||||||||| ||||||||    
47682438 tctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaag 47682381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 50485998 - 50486055
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| |||||||||||||||   || ||||||||||||||||||| ||||    
50485998 tctacgcacgagccggattagtcgcccaccattagtgggtcggaaaccgatgcaaaag 50486055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 52950070 - 52950127
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||| ||| |||| ||||||||||| | ||||| |||||||||||| ||||    
52950070 aaggacgtacctggggaatatcgggttcgattcccagggggaacaacgcttggccagt 52950127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 53599048 - 53599105
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| | ||| | ||||||| |||| ||||    
53599048 aaggacgtacccggggaataccgggttcgattcccaggaggaacaacgtttggccagt 53599105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 198 - 246
Target Start/End: Complemental strand, 48834747 - 48834699
Alignment:
198 gagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    ||||||||||||||||| |  ||| ||||||||||||||| ||||||||    
48834747 gagtcggattagtcgcctacctttggtgggtcggaaaccggtgcgaaag 48834699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 125 - 243
Target Start/End: Original strand, 68503 - 68621
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgctt-ggtcagtatggcttctacgtacgagtcggattagtcgcccattttttg 223  Q
    |||||||||||||||||||| ||||||||||| | ||||| |||||||||| |||  | || || |||||| ||||| |||||||||||||||  ||| |    
68503 aaggacgtacccgggaaatatcgggttcgattcccagggggaacaacgcttgggtgcgcat-gcctctacgcacgagccggattagtcgcccacctttgg 68601  T
224 tgggtcggaaaccgatgcga 243  Q
    ||||||| |||||| |||||    
68602 tgggtcgaaaaccggtgcga 68621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 556 - 680
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| ||||||||||||||||   ||||| |||||| |||| ||||| ||   || |||||||| ||| | |||||||||| ||  |||    
556 aaggacgtacccggggaataccgggttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcaccttt 655  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
656 ggtgggtcggaaaccggtgcgaaag 680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 319408 - 319465
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| ||||||||||| |||||||||||| |||||||||||| ||||    
319408 aaggacgtatccggggaataccgggtttgatttctagggggaacaacgcttggccagt 319465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 412149 - 412092
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| ||||||| ||||||||   ||||| |||||||||||||||||    
412149 aaggacgtatccggggaataccgagttcgattcacagggggaacaacgcttggtcagt 412092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 17)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 18915851 - 18915975
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||||||| |||||||||||||||| | ||||| |||||| ||||| |||| ||   || |||||| ||||| |||||||||||| ||   ||    
18915851 aaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccatt 18915950  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||| |||||||| ||||||||    
18915951 ggtgggttggaaaccggtgcgaaag 18915975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 127 - 246
Target Start/End: Complemental strand, 2981053 - 2980931
Alignment:
127 ggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttg 223  Q
    ||||||| ||||| ||||| |||||||||| | || || |||||| ||||| |||| ||   || |||||| ||||||||||||||||| |||| ||| |    
2981053 ggacgtatccggggaatactgggttcgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcggattagtcgtccatgtttag 2980954  T
224 tgggtcggaaaccgatgcgaaag 246  Q
    ||||||||||| || ||||||||    
2980953 tgggtcggaaatcggtgcgaaag 2980931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 40288601 - 40288487
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||||  |||| |||||||||||||||||| ||||| ||||||| |||| |||||||   || |||||  ||||| |||||||||||| |||  ||    
40288601 aaggacgtattcggggaataccgggttcgatttccagggggaacaacggttggccagtatgcatgcctctacacacgagccggattagtcgctcatcctt 40288502  T
222 tgtgggtcggaaacc 236  Q
     ||||||||||||||    
40288501 ggtgggtcggaaacc 40288487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 128 - 246
Target Start/End: Complemental strand, 43959942 - 43959821
Alignment:
128 gacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgt 224  Q
    |||||||||||| |||| ||||||| ||| | ||||| |||||||||||| ||||  |   || |||||| ||||| |||||||||||||||  ||| ||    
43959942 gacgtacccggggaatatcgggttcaattcccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagt 43959843  T
225 gggtcggaaaccgatgcgaaag 246  Q
    || |||||||||| ||||||||    
43959842 ggatcggaaaccggtgcgaaag 43959821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 30927851 - 30927727
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||||| |||||||| ||||||||||||| || || |||||||||||| || | ||   || |||||| | ||| ||||||||||| ||| ||||    
30927851 aaggacgtacctgggaaatatcgggttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccactttt 30927752  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||| ||||||| ||| ||||    
30927751 ggtgggtcagaaaccggtgcaaaag 30927727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 141 - 246
Target Start/End: Original strand, 15465965 - 15466073
Alignment:
141 aataccgggttcgatttctaggggaaacaacgcttggtcagt----atggcttctacgtacgagtcggattagtcgcccattttttgtgggtcggaaacc 236  Q
    |||||| ||||||||||| ||||| |||||||||||||||||    || || |||||| ||||||| |||| ||||| ||  ||| ||||||||||||||    
15465965 aataccaggttcgatttccagggggaacaacgcttggtcagtgcacat-gcctctacgcacgagtctgattggtcgctcacctttggtgggtcggaaacc 15466063  T
237 gatgcgaaag 246  Q
    ||| ||||||    
15466064 gatacgaaag 15466073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 9853401 - 9853354
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacg 172  Q
    ||||| |||||||| ||||||||||||||||| |||||||||||||||    
9853401 aaggatgtacccggaaaataccgggttcgattcctaggggaaacaacg 9853354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 41663980 - 41663856
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||||||||||||||| | ||||| |||||| ||||||||||  |   || |||||| | |||  |||||||||| |||   ||    
41663980 aaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccatt 41663881  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     ||||||||||||||| ||||||||    
41663880 ggtgggtcggaaaccggtgcgaaag 41663856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 128 - 182
Target Start/End: Original strand, 45536695 - 45536749
Alignment:
128 gacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    |||||||||||  |||||||||||||||||||| ||| |||||||||||| ||||    
45536695 gacgtacccggagaataccgggttcgatttctaaggggaacaacgcttggccagt 45536749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 49078098 - 49078155
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||| | |||||||||||| ||||| ||||    
49078098 aaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagt 49078155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 166 - 246
Target Start/End: Complemental strand, 50371917 - 50371834
Alignment:
166 aacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||||||| ||||| |   ||||||||| || || |||||||||||||||| ||| |||| |||||||||| ||||||||    
50371917 aacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaag 50371834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 3850801 - 3850742
Alignment:
187 cttctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||||| ||||| |||||||||||||||  |||  |||||||||||||| ||||||||    
3850801 cttctacgcacgaggcggattagtcgcccacctttaatgggtcggaaaccggtgcgaaag 3850742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 136 - 246
Target Start/End: Original strand, 34697330 - 34697443
Alignment:
136 cgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtgggtcgga 232  Q
    |||| |||||| |||||||||  |||||| |||||| |||||  ||| ||   || |||||| | ||| ||||||||||||||| ||||  ||||| |||    
34697330 cggggaataccaggttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatgagccggattagtcgcccacttttgatgggttgga 34697429  T
233 aaccgatgcgaaag 246  Q
    ||||||||||||||    
34697430 aaccgatgcgaaag 34697443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 246
Target Start/End: Complemental strand, 33004139 - 33004015
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    ||||||||| ||||| |||| ||| ||||||||| ||||||||||| |||||| ||||  |   || |||||| ||||| |||||||||| ||||    |    
33004139 aaggacgtatccggggaatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtcacccaccaat 33004040  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
     |||||||| |||||| ||||||||    
33004039 ggtgggtcgaaaaccggtgcgaaag 33004015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 31152700 - 31152757
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||| |||||| || ||||||||||||||||||  |||| || ||||||||||||||    
31152700 aaggatgtacccagggaataccgggttcgatttcccgggggaataacgcttggtcagt 31152757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 34334419 - 34334362
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||| ||||| |||||||||||||||| | ||||| |||||| ||||| ||||    
34334419 aaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagt 34334362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 48798191 - 48798143
Alignment:
128 gacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttg 176  Q
    |||||| ||||| |||| ||||||||||||| ||||| |||||||||||    
48798191 gacgtatccggggaatatcgggttcgatttccagggggaacaacgcttg 48798143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 246
Target Start/End: Original strand, 12656 - 12780
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttt 221  Q
    |||||||| |||||| ||||||||||||||||   ||| | |||||||||||| |||| ||   || |||||| ||||  |||||||||||||||  |||    
12656 aaggacgtgcccggggaataccgggttcgattcagaggaggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccaccttt 12755  T
222 tgtgggtcggaaaccgatgcgaaag 246  Q
      |||||| ||||||| ||||||||    
12756 gatgggtcagaaaccggtgcgaaag 12780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 246
Target Start/End: Original strand, 41032 - 41154
Alignment:
127 ggacgtacccgggaaataccgggttcgatt-tctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccatttttt 222  Q
    |||||||| | || |||| ||||||||||| || ||||||| |||| |||||||||| ||   || |||||| ||||| |||||||||||||||| |||     
41032 ggacgtactcagggaatatcgggttcgattctcaaggggaa-caacacttggtcagtgtgcatgcctctacgcacgagccggattagtcgcccatctttg 41130  T
223 gtgggtcggaaaccgatgcgaaag 246  Q
    ||| ||||||||||| | ||||||    
41131 gtgagtcggaaaccggttcgaaag 41154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 189 - 246
Target Start/End: Original strand, 224370 - 224427
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| ||||||||||| |||| ||| ||||||||||||||| ||||||||    
224370 tctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag 224427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 271197 - 271140
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||  |||| ||||||||||| | ||||| |||||||||||||||||    
271197 aaggacgtacccggagaatatcgggttcgattcccagggggaacaacgcttggtcagt 271140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 212
Target Start/End: Original strand, 26169 - 26259
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcg 212  Q
    |||||| |||| ||| ||||| |||||||||||| ||||| |||||||||||| |||| ||   || |||||| ||||| |||||||||||    
26169 aaggacatacctggggaatactgggttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcg 26259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 131 - 246
Target Start/End: Complemental strand, 42949 - 42831
Alignment:
131 gtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgcccattttttgtggg 227  Q
    ||||| ||| |||| ||||||||||| ||||||  ||||| |||||||||||  |   || |||||  | ||| |||||||||||||||  ||| |||||    
42949 gtacctggggaatatcgggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtggg 42850  T
228 tcggaaaccgatgcgaaag 246  Q
    |||||||||| ||||||||    
42849 tcggaaaccggtgcgaaag 42831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 183
Target Start/End: Original strand, 9422 - 9480
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagta 183  Q
    ||||||||||  ||| |||||||||||||||| | ||||| |||||||||||| |||||    
9422 aaggacgtacttggggaataccgggttcgattcccagggggaacaacgcttggccagta 9480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0332 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0332
Description:

Target: scaffold0332; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 167
Target Start/End: Original strand, 15317 - 15359
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaa 167  Q
    ||||| ||||||||| |||||||||||||||||| ||||||||    
15317 aaggaagtacccggggaataccgggttcgatttccaggggaaa 15359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 216
Target Start/End: Original strand, 12561 - 12653
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagtatg---gcttctacgtacgagtcggattagtcgccca 216  Q
    |||||||||| || |||||||||||||||||| ||||||  |||||||||||  ||||  |   || |||||| | |||||||||||||||||||    
12561 aaggacgtactcgagaaataccgggttcgattcctaggg--aacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgccca 12653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 8161 - 8217
Alignment:
125 aaggacgtacccgggaaataccgggttcgatttctaggggaaacaacgcttggtcagt 182  Q
    ||||||||||||||| |||||||||||||||| | | ||| |||||||||||| ||||    
8161 aaggacgtacccggggaataccgggttcgattcccaaggg-aacaacgcttggccagt 8217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 155767 - 155710
Alignment:
189 tctacgtacgagtcggattagtcgcccattttttgtgggtcggaaaccgatgcgaaag 246  Q
    |||||| ||||| |||||||||||||||  ||| ||||||||||| ||| ||||||||    
155767 tctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaag 155710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University