View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_125 (Length: 349)
Name: NF1199_low_125
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_125 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 100 - 317
Target Start/End: Original strand, 4686049 - 4686269
Alignment:
| Q |
100 |
ataaactggtgatttcatactcttcaatacattattcaatatgttacttgatggaggtagacctgctggatatgttgatcctgataatggttgaagttgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4686049 |
ataaactggtgatttcatactcttcaatacattattcaatatgttacttgatggaggtagacctgctggatatgttgatcctgataatggttcaagttgt |
4686148 |
T |
 |
| Q |
200 |
ccactacaactattttttggttgattccactcctttcccctgtgttcgttcaagtcacaaaatatgataaattttgttttaat---ttattttcagcatt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4686149 |
ccactacaactattttttggttgattccactcctttcccctgtgttcgttcaagtcacaaaatatgattaattttgttttaatttattattttcagcatt |
4686248 |
T |
 |
| Q |
297 |
atggaatatacaaaaatggat |
317 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4686249 |
atggaatatacaaaaatggat |
4686269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University