View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_128 (Length: 347)
Name: NF1199_low_128
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_128 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 37 - 318
Target Start/End: Complemental strand, 41875133 - 41874852
Alignment:
| Q |
37 |
gaaagattcattcttaatgggaagcaccaaaagtgaattgtactttgtctttctgatctatgatcaagaatacgagcgacttcgaactaatcggtatgtc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41875133 |
gaaagattcattcttaatgggaagcaccaaaagtgaattgtactttgtctttctgatctatgatcaagaatacgagcgacttcgaactaatcggtatgtc |
41875034 |
T |
|
| Q |
137 |
ttcatcatgtctttgttttattatttgtaacaatatgcgattaattaacattacttttaaacatttatgttgtgctaaattttttaattagaaccaagag |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41875033 |
ttcatcatgtctttgttttattatttgtaacaatatgcgattaattaacattacttttaaacatttatgttgtgctaaattttttaattagaaccaagag |
41874934 |
T |
|
| Q |
237 |
tggggcaaataagcttgatttgtaccttagtagaaagcatgatgagcttttagcaagcactctagacccaggaagctacaag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41874933 |
tggggcaaataagcttgatttgtaccttagtagaaagcatgatgagcttttagcaagcactctagagccaggaagctacaag |
41874852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University