View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_131 (Length: 339)
Name: NF1199_low_131
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_131 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 5871257 - 5871513
Alignment:
| Q |
1 |
ccaggatatcttccaggaagactttatgatcttgatgcatcaaaatacggttcaaaagatgacctaaagtcactaattgcagctttcaaagataaaggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5871257 |
ccaggatatcttccaggaagactttatgatcttgatgcatcaaaatacggttcaaaagatgacctaaagtcactaattgcagctttcaaagataaaggaa |
5871356 |
T |
 |
| Q |
101 |
tcaattgtctagctgacatagtgatcaaccatagaacagcagaaagaaaagatgatagaggcatctattgcctctttgaaggtgggactcctgattcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5871357 |
tcaattgtctagctgacatagtgatcaaccatagaacagcagaaagaaaagatgatagaggcatctattgcctctttgaaggtgggactcctgattcaaa |
5871456 |
T |
 |
| Q |
201 |
acttgattggggcccatctttcatttgcaaagatgacactgcttattcagatggcac |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5871457 |
acttgattggggcccatctttcatttgcaaagatgacactgcttattcagatggcac |
5871513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 299 - 334
Target Start/End: Original strand, 53491223 - 53491258
Alignment:
| Q |
299 |
aacctgtgaaaaattgaagtgatttatttggtatct |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53491223 |
aacctgtgaaaaattgaagtgatttatttggtatct |
53491258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University