View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_135 (Length: 334)
Name: NF1199_low_135
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_135 |
 | |
|
| [»] scaffold0331 (2 HSPs) |
| | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 85 - 199
Target Start/End: Original strand, 26898930 - 26899044
Alignment:
| Q |
85 |
aaccaaccacataacgccacatcctctgtttcaagtcttttctctgaatgtgggaccccttttgcttgacatctgctttccgacaaattttcgtcggtaa |
184 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| |
|
|
| T |
26898930 |
aaccaaccaaataacgccacgtcctctgtttcaagtcttttctctgaatgtgggaccccttttgcttggcatctgctttccgacgaattttcgtcgataa |
26899029 |
T |
|
| Q |
185 |
ttccctaggtaattt |
199 |
Q |
| |
|
|| ||| |||||||| |
|
|
| T |
26899030 |
tttcctcggtaattt |
26899044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0331 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold0331
Description:
Target: scaffold0331; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 85 - 198
Target Start/End: Complemental strand, 176 - 63
Alignment:
| Q |
85 |
aaccaaccacataacgccacatcctctgtttcaagtcttttctctgaatgtgggaccccttttgcttgacatctgctttccgacaaattttcgtcggtaa |
184 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
176 |
aaccaaccacatagcgccacgtcctctgtttcaagtcttttctttgaatgtgggaccccttttgcctgacatctgctttccgacgaatttccgtcggtaa |
77 |
T |
|
| Q |
185 |
ttccctaggtaatt |
198 |
Q |
| |
|
|| ||| ||||||| |
|
|
| T |
76 |
tttcctcggtaatt |
63 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0331; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 178 - 230
Target Start/End: Complemental strand, 71 - 19
Alignment:
| Q |
178 |
tcggtaattccctaggtaatttttgtaggaaaatctcatatttgttgtagtga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
71 |
tcggtaattccctaggtaatttttgtaggaaaatcacaaatttcttgtagtga |
19 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 69 - 165
Target Start/End: Complemental strand, 23406645 - 23406549
Alignment:
| Q |
69 |
atcctatatataataaaaccaaccacataacgccacatcctctgtttcaagtcttttctctgaatgtgggaccccttttgcttgacatctgctttcc |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23406645 |
atcctatatatgataaaaccaaccacataacgccatgtcctttgtttcaagtcttttctctgaatgtgggaccccttttgcctgacatctgctttcc |
23406549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 113 - 182
Target Start/End: Original strand, 107 - 176
Alignment:
| Q |
113 |
tttcaagtcttttctctgaatgtgggaccccttttgcttgacatctgctttccgacaaattttcgtcggt |
182 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| |||||| || ||| |||| ||||||||||||| |
|
|
| T |
107 |
tttcaagtcttttctctgcacgtgggaccccttttgactgacatatgtttttcgacgaattttcgtcggt |
176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University