View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_low_136 (Length: 332)

Name: NF1199_low_136
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_low_136
NF1199_low_136
[»] chr3 (2 HSPs)
chr3 (30-322)||(2181050-2181342)
chr3 (286-322)||(10730511-10730547)
[»] chr5 (2 HSPs)
chr5 (292-321)||(25693898-25693927)
chr5 (292-320)||(10332244-10332272)


Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 30 - 322
Target Start/End: Original strand, 2181050 - 2181342
Alignment:
30 attacaacatgtccacttttgcagatgcattgcactgtgaatgagccataccatttcttcttggactcagtatgatggtagaaaatgttggcagttctaa 129  Q
    ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
2181050 attacaacatgtctacttttgcagatgcattgcacagtgaatgagccataccatttcttcttggactgagtatgatggtagaaaatgttggcagttctaa 2181149  T
130 gcattaccttatcagctccaacttcaaattatggcctttcttcaaactttctcattgcccttgccaaatattcccctaagcttgcgttgtcgcctaattc 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2181150 gcattaccttatcagctccaacttcaaattatggcctttcttcaaactttctcattgcccttgccaaatattcccctaagcttgcgttgtcgcctaattc 2181249  T
230 ttcattcagctcccttgcttgggtgactttgagtttcggtgatattggcgactttgtttatatttggcttaattgtacttttggccccctatg 322  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
2181250 ttcattcagctcccttgcttgggtgactttgagtttcggtgatattggcgactttgtttatatttggcttaattgcacttttggccccctatg 2181342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 286 - 322
Target Start/End: Original strand, 10730511 - 10730547
Alignment:
286 tttatatttggcttaattgtacttttggccccctatg 322  Q
    ||||| |||||||||||||||||||||||||||||||    
10730511 tttatttttggcttaattgtacttttggccccctatg 10730547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 321
Target Start/End: Original strand, 25693898 - 25693927
Alignment:
292 tttggcttaattgtacttttggccccctat 321  Q
    ||||||||||||||||||||||||||||||    
25693898 tttggcttaattgtacttttggccccctat 25693927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 292 - 320
Target Start/End: Complemental strand, 10332272 - 10332244
Alignment:
292 tttggcttaattgtacttttggcccccta 320  Q
    |||||||||||||||||||||||||||||    
10332272 tttggcttaattgtacttttggcccccta 10332244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University