View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_139 (Length: 328)
Name: NF1199_low_139
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_139 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 215 - 289
Target Start/End: Complemental strand, 10478240 - 10478166
Alignment:
| Q |
215 |
acctatcgaatattctgattagaatagttagctaggaagcttggttaggaattaggatattcactatataataaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10478240 |
acctatcgaatattctgattagaatagttagctaggaagcttggttaggaattaggatattcactatataataaa |
10478166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University