View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_146 (Length: 317)
Name: NF1199_low_146
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_146 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 26 - 221
Target Start/End: Original strand, 615357 - 615563
Alignment:
| Q |
26 |
atgatgatgtaagaaattgagaggattcctattcctctatctgtgc-----------ttatttataggcaattttaaggtgtataaatgaaataagttac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
615357 |
atgatgatgtaagaaattgagaggattcctattcctctatctgtgtgcttgggacttttatttataggcaattttaaggtgtataaatgaaataagttac |
615456 |
T |
 |
| Q |
115 |
atattactagtttttatcattaatataatggtgattcttattgatacaatggtgaaaaacatacttgtccattaaatctgagagcctcatagtttaattt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
615457 |
atattactagtttttatcattaatataatggtgattcttattgatacaatggtgaaaaacatacttgtccattaaatttgagagcctcatagtttaattt |
615556 |
T |
 |
| Q |
215 |
ctacctt |
221 |
Q |
| |
|
||||||| |
|
|
| T |
615557 |
ctacctt |
615563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University