View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_148 (Length: 315)
Name: NF1199_low_148
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_148 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 29 - 315
Target Start/End: Complemental strand, 53983289 - 53983003
Alignment:
| Q |
29 |
accccgcccactacttgaaataccatcgtagatgcatttgttctttattttaattttaatatgatattataaaactttgctgtcgaaagcatacttgccc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53983289 |
accccgcccactacttgaaataccatcgtagatgcatttgttctttattttaattttaatatgatattataaaactttgctgtcgaaagcatacttgccc |
53983190 |
T |
 |
| Q |
129 |
attgctgatgtgaatcttagataaacaaatgggattggagaggatataattttgatcaaaactccccctcttgaatgaataataatgggattttccatat |
228 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53983189 |
attactgatgtgaatcttagataaacaaatgggattggagaggatataattttgatcaaaactccccctcttgaatgaataataatgggattttccatat |
53983090 |
T |
 |
| Q |
229 |
caagggggagttgggcagaggtaatggatccgtgattggagcttcaaacttggagttgaatttcccaaattacattaagtctatgtg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53983089 |
caagggggagttgggcagaggtaatggatccatgattggagcttcaaacttggagttgaatttcccaaattacattaagtctatgtg |
53983003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University