View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_152 (Length: 309)
Name: NF1199_low_152
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_152 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 72 - 161
Target Start/End: Original strand, 3450176 - 3450265
Alignment:
| Q |
72 |
ctgttgcgacaatttggtcctaaagattttaaagacgttaatattgaggttgcatactgcaatttcaaaaccatgatttatgaatcgcac |
161 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3450176 |
ctgttgcgataatttggtcctaaagattttaaagacgttaatattgaggttgcatactgcaatttcaaaaccatgatttatggatcgcac |
3450265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 174 - 223
Target Start/End: Complemental strand, 8762399 - 8762350
Alignment:
| Q |
174 |
ttcactgatggtgcttcctctagcttttcatcatatagaggtgaacaagg |
223 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8762399 |
ttcaatgatggtgcttccactagcttttcatcatatagaggtgaacaagg |
8762350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 8788925 - 8788881
Alignment:
| Q |
179 |
tgatggtgcttcctctagcttttcatcatatagaggtgaacaagg |
223 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8788925 |
tgatggtgcttccactagcttttcatcatatagaggtgaacaagg |
8788881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University