View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_159 (Length: 301)
Name: NF1199_low_159
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_159 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 51414536 - 51414249
Alignment:
| Q |
1 |
tcatcagagcatcttgaacccttaagaactgaatggttaacaattctattcattaggccaccaatcccattgagatccacttcttgaaccttcctgccca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51414536 |
tcatcagagcatctttttcccttaagaactgaatggttaacaattctattcattagaccaccaatcccattgagatccacttcttgaaccttcctgctca |
51414437 |
T |
|
| Q |
101 |
ctcatcggtccttatttacacatagtcattttcattctcttatgaatttgtttcaattatgtgttgatttgcctcgaaacatgtcagaagaaacagttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51414436 |
ctcatcggtccttatttacacatagtcattttcattctcttatgaatttgtttcaattatgtgttgatttgcttcgaaacatgtcagaagaaacagttta |
51414337 |
T |
|
| Q |
201 |
ttaaatatatcatagtgtcatgcattggtgatgactattcacgttcctcgtcaacccaattacacaactaaaaataaaaatgaccttc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51414336 |
ttaaatatatcatagtgtcatgcattggtgatgactatttacgtccctcgtcaacctaattacacaactaaaaataaaaatgaccttc |
51414249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University