View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_low_170 (Length: 289)

Name: NF1199_low_170
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_low_170
NF1199_low_170
[»] chr3 (1 HSPs)
chr3 (33-193)||(54549586-54549746)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 33 - 193
Target Start/End: Complemental strand, 54549746 - 54549586
Alignment:
33 attattcttcattcaaatcataattgatgataattttttgggaaaaagggacaacatcagaattatagaggatgaaagagaaaactggttttactatctc 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54549746 attattcttcattcaaatcataattgatgataattttttgggaaaaagggacaacatcagaattatagaggatgaaagagaaaactggttttactatctc 54549647  T
133 ttaattggttttggaaacgtctttaagcgtctgtttagttgcacattgcacactcgaaatg 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54549646 ttaattggttttggaaacgtctttaagcgtctgtttagttgcacattgcacactcgaaatg 54549586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University