View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_172 (Length: 282)
Name: NF1199_low_172
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_172 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 30 - 199
Target Start/End: Original strand, 51200782 - 51200951
Alignment:
| Q |
30 |
ggaagcaatggcttgtcaatgaattcaaagaatgaatccacaaaaacgtcgatcaatttagccacggtatttttcatagttttgggaatatctatttgca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51200782 |
ggaagcaatggcttgtcaatgaattcaaagaatgaatccacaaaaacgtcgatcaatttagccacagtatttttcatagttttgggaatatctatttgca |
51200881 |
T |
|
| Q |
130 |
aggagacttcaggtagagttggtctcgtgtttgactgctcagtgagttgattagcatcatattcaaccag |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51200882 |
aggagacttcgggtagagttggtctcgtgtttgactgctcagtgagttgattagcatcatattcaaccag |
51200951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 228 - 270
Target Start/End: Original strand, 51200980 - 51201022
Alignment:
| Q |
228 |
ttaagttcatgcttaccttaaaaatagagaagagtggaatatt |
270 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51200980 |
ttaaattcatgcttaccttgaaaatagagaagagtggaatatt |
51201022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University