View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_180 (Length: 270)
Name: NF1199_low_180
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_180 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 130 - 254
Target Start/End: Original strand, 40433337 - 40433459
Alignment:
| Q |
130 |
ttaataaaggttaagagttttattcgtaaaaacaatcaccttgatgagtgccatattttccatgattaaggagtgtgtaattagcttctggctgcgaatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
40433337 |
ttaataaaggttaagagttttattcgtaaaaacaatcaccttgatgagtgccatattttccatgattaggga--gtgtaattagcttctggctgcgaatc |
40433434 |
T |
 |
| Q |
230 |
cggacccaaagcagcaacatcctta |
254 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40433435 |
cggacccaaagcagcaacatcctta |
40433459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 29 - 124
Target Start/End: Original strand, 40432523 - 40432614
Alignment:
| Q |
29 |
aattaaactttgaacttatcacattttatttgatgtgatgaatgtgagacgatgttacatgtttttggtttttctatctatcatgcataaatttat |
124 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40432523 |
aattaaactttgaacttaccacattttatttgatgtgatgaatgtgagacgttgttacatgtttttggtttt----tctatcatgcataaatttat |
40432614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University