View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_low_184 (Length: 263)

Name: NF1199_low_184
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_low_184
NF1199_low_184
[»] chr2 (2 HSPs)
chr2 (45-110)||(44632866-44632931)
chr2 (181-263)||(44632735-44632828)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 45 - 110
Target Start/End: Complemental strand, 44632931 - 44632866
Alignment:
45 aaaactgtttatgctgtcccttaagttaattttatatgatttagtcattcacctatgtttctacat 110  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
44632931 aaaactgtttatgctgtccattaagttaattttatatgatttagtcattcacctatgtttctacat 44632866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 181 - 263
Target Start/End: Complemental strand, 44632828 - 44632735
Alignment:
181 atgcgtaactttgtctaaaataaatcactttaaccttgttgaatcgt-----------actattataatatgatttagatgaattgaagatgtc 263  Q
    ||||||||||||||||||||||||||||||||||||||| |||| ||           |||||||||||||||||| |||||||||||||||||    
44632828 atgcgtaactttgtctaaaataaatcactttaaccttgtcgaattgtatattgtaatgactattataatatgatttcgatgaattgaagatgtc 44632735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University