View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_184 (Length: 263)
Name: NF1199_low_184
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_184 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 45 - 110
Target Start/End: Complemental strand, 44632931 - 44632866
Alignment:
| Q |
45 |
aaaactgtttatgctgtcccttaagttaattttatatgatttagtcattcacctatgtttctacat |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44632931 |
aaaactgtttatgctgtccattaagttaattttatatgatttagtcattcacctatgtttctacat |
44632866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 181 - 263
Target Start/End: Complemental strand, 44632828 - 44632735
Alignment:
| Q |
181 |
atgcgtaactttgtctaaaataaatcactttaaccttgttgaatcgt-----------actattataatatgatttagatgaattgaagatgtc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44632828 |
atgcgtaactttgtctaaaataaatcactttaaccttgtcgaattgtatattgtaatgactattataatatgatttcgatgaattgaagatgtc |
44632735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University