View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_186 (Length: 261)
Name: NF1199_low_186
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_186 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 261
Target Start/End: Complemental strand, 13067398 - 13067143
Alignment:
| Q |
6 |
ctccaagaatataaaaaatttcttggaattagttggaccccctctcatagttgccaaaactctgctcatgatgtggataacgttcattgatcagttcagt |
105 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13067398 |
ctccaaaaatataaaaaatttcatggaattagttggaccccctctcatagttgccaaaactctgctcatgatgtggataacgttcattgatcagttcagt |
13067299 |
T |
 |
| Q |
106 |
ggtaataataaagcttgtgtttgtgaaccaccgtcctttaattttggacagaggagataaaaacgtcggtagcataccaattattgtccaatttggcata |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13067298 |
ggtaataataaagcttgtgtttgtgaaccaccgtcctttaattttggacagaggagataaaaacgtcgctagcataccaattattgtccaatttggcata |
13067199 |
T |
 |
| Q |
206 |
attctatcgctatccgtctcaaatagtggacagatatgaaaaaggggatggctaca |
261 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13067198 |
attctatcgctatccgtctccaatagtggacagatatgaaaaaggggatggctaca |
13067143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University