View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_205 (Length: 251)
Name: NF1199_low_205
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_205 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 2524453 - 2524698
Alignment:
| Q |
7 |
tcgaagaatatcgtgatagaagattcaaccattcaagcaggtaatcaaagtcaaattattttttcttatatataaacactatcaatttaatattttatag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2524453 |
tcgaagaatatcgtgatagaagattcaaccattcaagcaggtaatcaaagtcaaattattttttcttatatataaacactatcaatttaatattttatag |
2524552 |
T |
|
| Q |
107 |
atgcatctaaaaatgtattctcaacc-aagggttactatgctactaaggatgtttagtcatccataacgttttgagtttaaattccgtcgttagtgtgaa |
205 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
2524553 |
atgcatctaaaaatgtattgtcaaccaaagggttactatgctactaaggatgttgagtcatccataacgttttgagtttaacttccgttgttagtgtgaa |
2524652 |
T |
|
| Q |
206 |
attagtctacaccacnnnnnnnattgcaaaatctcaaatttgtgcc |
251 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
2524653 |
attagtctacaccactttttttattgccaaatctcaaatttgtgcc |
2524698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University