View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1199_low_214 (Length: 244)

Name: NF1199_low_214
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1199_low_214
NF1199_low_214
[»] chr1 (1 HSPs)
chr1 (33-162)||(5871384-5871513)
[»] chr3 (1 HSPs)
chr3 (204-239)||(53491223-53491258)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 33 - 162
Target Start/End: Original strand, 5871384 - 5871513
Alignment:
33 accacagaacagcagaaagaaaagatgatagaggcatctattgcctctttgaaggtgggactcctgattcaaaacttgattggggcccatctttcatttg 132  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5871384 accatagaacagcagaaagaaaagatgatagaggcatctattgcctctttgaaggtgggactcctgattcaaaacttgattggggcccatctttcatttg 5871483  T
133 caaagatgacactgcttattcagatggcac 162  Q
    ||||||||||||||||||||||||||||||    
5871484 caaagatgacactgcttattcagatggcac 5871513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 204 - 239
Target Start/End: Original strand, 53491223 - 53491258
Alignment:
204 aacctgtgaaaaattgaagtgatttatttggtatct 239  Q
    ||||||||||||||||||||||||||||||||||||    
53491223 aacctgtgaaaaattgaagtgatttatttggtatct 53491258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University