View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_234 (Length: 210)
Name: NF1199_low_234
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_234 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 23 - 195
Target Start/End: Original strand, 18219075 - 18219247
Alignment:
| Q |
23 |
cagtatgttcatcaaggttggttacaacatgtggagacaagctcatgtttggccacataaaggtccctcttggtttgcaaatttggaaaccacttttcag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18219075 |
cagtatgttcatcaaggttggttacaacatgtggagacaagctcatgtttggccacataaaggtccctcttggtttgcaaatttggaaaccacttttcag |
18219174 |
T |
|
| Q |
123 |
cctttctatctttgctgctttgtcctctgctgctctgcttcctactaccatttgtgtgtcttctgatattgtt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
18219175 |
cctttctatctttgctgctttgtcctctgctgctctgcttcctactaccatttgtgtgtctgctgattttgtt |
18219247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 23 - 99
Target Start/End: Original strand, 43011017 - 43011093
Alignment:
| Q |
23 |
cagtatgttcatcaaggttggttacaacatgtggagacaagctcatgtttggccacataaaggtccctcttggtttg |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| ||| | |||| |||||||||||||||||||| |||| |
|
|
| T |
43011017 |
cagtgtgttcatcaaggttggttacaacatgtggatacaaactcgtatttgaccacataaaggtccctcttgttttg |
43011093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 155 - 195
Target Start/End: Original strand, 43011096 - 43011136
Alignment:
| Q |
155 |
ctctgcttcctactaccatttgtgtgtcttctgatattgtt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
43011096 |
ctctgcttcctactaccatttgtgtgtctgctgattttgtt |
43011136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University