View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_238 (Length: 209)
Name: NF1199_low_238
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_238 |
 |  |
|
| [»] scaffold1528 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1528 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold1528
Description:
Target: scaffold1528; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 700 - 750
Alignment:
| Q |
1 |
ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctgggat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
700 |
ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctaggat |
750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 17753976 - 17754026
Alignment:
| Q |
1 |
ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctgggat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17753976 |
ctgcggctttgttgtatggaaagtgattcggtggccgtttctgtctaggat |
17754026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University