View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_79 (Length: 422)
Name: NF1199_low_79
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 236 - 415
Target Start/End: Complemental strand, 12828232 - 12828051
Alignment:
| Q |
236 |
ggtttcgccttcatgctactgagccgactgggtctctttttgtcatcacttgttgggaaatttggaaacctaggaac--gaagagatcttccaagcaaat |
333 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
12828232 |
ggtttcgccttcatgctactgggccgactgggtctctttttgtcatcacttgttgggaaatttggaaagctaggaacacgaagagatctttcaagcaaat |
12828133 |
T |
 |
| Q |
334 |
agaaagcctacatggttgattgttaattctatatttaacactcgtaattttattttgcaggttttgaatacaacctatgcta |
415 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
12828132 |
agaaagcctacatggttgattgttaattgtatatttaacactcgtaattttattttgcaggttttgcatacaacctctgcta |
12828051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University