View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1199_low_96 (Length: 397)
Name: NF1199_low_96
Description: NF1199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1199_low_96 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 177 - 298
Target Start/End: Complemental strand, 962246 - 962125
Alignment:
| Q |
177 |
cttaccttggattatgttttttctattacatagtaatgttacatcatgttcatgctcgtgtctttcgcaatagtaatgcgcattttctttttatcttaac |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
962246 |
cttaccttggattatgttttttctattacatagtaatgttacatcatgctcatgctcgtgtcttttgcaatagtaatgcgcattttctttttatcttaac |
962147 |
T |
|
| Q |
277 |
cctccgattcgttagagaaaaa |
298 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
962146 |
cctccgattcgttagagaaaaa |
962125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 84 - 137
Target Start/End: Complemental strand, 962337 - 962284
Alignment:
| Q |
84 |
caagaatatgaagacgtggcacatccctaatgtttagtgcacatttttcttttg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
962337 |
caagaatatgaagacgtggcacatccctaatgtttagtgcacatttttcttttg |
962284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University