View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_high_16 (Length: 368)
Name: NF12001_high_16
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_high_16 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 190 - 368
Target Start/End: Original strand, 1807894 - 1808072
Alignment:
| Q |
190 |
cctcatcatgtctaaaaacaatgatattgtaacatcaaatctttgtttttcaaatagtagaacacatttataacaaactatgctttttcaggtcagcaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807894 |
cctcatcatgtctaaaaacaatgatattgtaacatcaaatctttgtttttcaaatagtagaacacatttataacaaactatgctttttcaggtcagcaac |
1807993 |
T |
|
| Q |
290 |
ttggtactgtgtctactttaccatatttgagcccagaattaaaaggacgtaaacttctaattggtgccaattttggttc |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807994 |
ttggtactgtgtctactttaccatatttgagcccagaattaaaaggacgtaaacttctaattggtgccaattttggttc |
1808072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 1807706 - 1807751
Alignment:
| Q |
1 |
aatgacaaaattggatacaaaaatagaccccaaatttatgggcgac |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807706 |
aatgacaaaattggatacaaaaatagaccccaaatttatgggcgac |
1807751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University