View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_high_37 (Length: 241)
Name: NF12001_high_37
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_high_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 241
Target Start/End: Complemental strand, 24950827 - 24950592
Alignment:
| Q |
6 |
agatgaaaccctaggaaagtgtatgattcctttgcagatggtgcaaaggcggttagaccataagccggtgaacactcggtggcataatcttgagaagcac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24950827 |
agatgaaaccctaggaaagtgtatgattcctttgcagatggtgcaaaggcggttagaccataagccggtgaacactcggtggcataatcttgagaagcac |
24950728 |
T |
 |
| Q |
106 |
ttggttgttgaaggtgnnnnnnnggacacgaaatttgcaagcaggatacatttaaggttatgtttggatggaggataccacgtgctggacgagtcaacgc |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24950727 |
ttggttgttgaaggtgaaaaaaaggacacgaaatttgcaagcaggatacatttaaggttatgtttggatggaggataccacgtgctggacgagtcaacgc |
24950628 |
T |
 |
| Q |
206 |
atcacagtagtgatcttaggccaacggcgaagcagc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24950627 |
atcacagtagtgatcttaggccaacggcgaagcagc |
24950592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University