View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_high_40 (Length: 237)
Name: NF12001_high_40
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_high_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 57 - 223
Target Start/End: Original strand, 20527459 - 20527624
Alignment:
| Q |
57 |
atattgttgatgagtggtcttgatatgtttcgatgaattttttgccttgaggttgtattaaagttgaacnnnnnnnggtttattccatgtgtatcttgtg |
156 |
Q |
| |
|
|||||||||| ||| || |||||||||||||||| | |||||||||||||| |||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
20527459 |
atattgttgaggagcgg-cttgatatgtttcgatcatttttttgccttgagagtgtattaaggttgaactctttttggtttattccatgagtatcttgtg |
20527557 |
T |
|
| Q |
157 |
cttagaatagagttttcacctcaatgacgcaatgctctctaggaataattttggatttgtgtttcat |
223 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
20527558 |
cttagaatagagttttcaccttagtgacgccttgctgtctaggaatgattttggatttgtgtttcat |
20527624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 20527314 - 20527355
Alignment:
| Q |
18 |
aaataggcctgagttaaaatggtggctcggttttggtgaata |
59 |
Q |
| |
|
||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
20527314 |
aaataggcctgagttaaaatgtttgctcgtttttggtgaata |
20527355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University