View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_high_46 (Length: 216)
Name: NF12001_high_46
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 24205342 - 24205272
Alignment:
| Q |
134 |
aactcttcttcatacattgtttcttccatttcgtattcgcgctcaacaaaactagccgagtcttcttctct |
204 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24205342 |
aactcttcttcatacattgtttcttccttttcgtattcgcgctcaacaaaactagccgagtcttcttctct |
24205272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 24205458 - 24205407
Alignment:
| Q |
18 |
caagtcctccttgtcttgcatttttcaattccaatttgatttgttccattac |
69 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24205458 |
caagtcctccttgtcttgcatttttcagttccaatttgatttgttccattac |
24205407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University