View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_high_47 (Length: 213)
Name: NF12001_high_47
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_high_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 6506637 - 6506825
Alignment:
| Q |
11 |
gagagaagaattttgaggggtcagggaggacagtggaattaccctgtgggaatagaaaaggtttgttcttgttgatagtagaagacatggtgtctggtta |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
6506637 |
gagagaagaatttggaggggtcagggaggacagtggaattaccttgtgggaatagaaaaggtttgttcttgttgatagtagaagacatggtgtatgctta |
6506736 |
T |
|
| Q |
111 |
tgatggtaatggccttgatggttattgtagtagtaatggatcatgagttttatagtgtttgatggttatgtgtgttgagtgaatttctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6506737 |
tgatggtaatggccttgatggttattgtagtagtgatggatcatgagttttatagtgtttgatgattatgtgtgttgagtgaatttctt |
6506825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 6529350 - 6529408
Alignment:
| Q |
11 |
gagagaagaattttgaggggtcagggaggacagtggaattaccctgtgggaatagaaaa |
69 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
6529350 |
gagagaagaatttggaggggtcaggaaggacagtggagttaccttgtgggaatagaaaa |
6529408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 11 - 75
Target Start/End: Original strand, 6466484 - 6466548
Alignment:
| Q |
11 |
gagagaagaattttgaggggtcagggaggacagtggaattaccctgtgggaatagaaaaggtttg |
75 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||| | |||||||||||| ||||||||| |
|
|
| T |
6466484 |
gagagaagaagtttgtggggtcagggaggaccgtggaatgagtctgtgggaataggaaaggtttg |
6466548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 12 - 48
Target Start/End: Complemental strand, 6460847 - 6460811
Alignment:
| Q |
12 |
agagaagaattttgaggggtcagggaggacagtggaa |
48 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6460847 |
agagaagaatttggaggggtcagggaggacagtggaa |
6460811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 6519597 - 6519559
Alignment:
| Q |
11 |
gagagaagaattttgaggggtcagggaggacagtggaat |
49 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
6519597 |
gagagaagaatttggaggggtcagggtggacagtggaat |
6519559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University