View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12001_low_33 (Length: 254)

Name: NF12001_low_33
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12001_low_33
NF12001_low_33
[»] chr1 (1 HSPs)
chr1 (1-238)||(43864749-43864987)


Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 43864987 - 43864749
Alignment:
1 gtctaaattgttatgttttggactgaccaaggtccaatccgtgaaggatccacgatccacctaagtaagcaacaccgtgttccacaacacatcaaataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43864987 gtctaaattgttatgttttggactgaccaaggtccaatccgtgaaggatccacgatccacctaagtaagcaacaccgtgttccacaacacatcaaataaa 43864888  T
101 actccatgatcatatcaccaccctttaatactaaccatgttttggacagaaatttggtttcaaaattgcaaattactatttttggacact-ttttagtta 199  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
43864887 acaccatgatcatatcaccaccctttaatactaaccatgttttggacagaaatttggtttcaaaattgcaaattactatttttggacacttttttagtta 43864788  T
200 cttctagaacctgtcatccggttgatggcttcttctcct 238  Q
    |||||||||||||||||||||||||||||||||||||||    
43864787 cttctagaacctgtcatccggttgatggcttcttctcct 43864749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University