View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_low_33 (Length: 254)
Name: NF12001_low_33
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 43864987 - 43864749
Alignment:
| Q |
1 |
gtctaaattgttatgttttggactgaccaaggtccaatccgtgaaggatccacgatccacctaagtaagcaacaccgtgttccacaacacatcaaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864987 |
gtctaaattgttatgttttggactgaccaaggtccaatccgtgaaggatccacgatccacctaagtaagcaacaccgtgttccacaacacatcaaataaa |
43864888 |
T |
|
| Q |
101 |
actccatgatcatatcaccaccctttaatactaaccatgttttggacagaaatttggtttcaaaattgcaaattactatttttggacact-ttttagtta |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43864887 |
acaccatgatcatatcaccaccctttaatactaaccatgttttggacagaaatttggtttcaaaattgcaaattactatttttggacacttttttagtta |
43864788 |
T |
|
| Q |
200 |
cttctagaacctgtcatccggttgatggcttcttctcct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864787 |
cttctagaacctgtcatccggttgatggcttcttctcct |
43864749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University