View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_low_39 (Length: 241)
Name: NF12001_low_39
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 15 - 225
Target Start/End: Complemental strand, 52718364 - 52718162
Alignment:
| Q |
15 |
caaagggaacaataccttggggaagtgcagcctgcaaattaaaatcaaacataattatggtaacaaactgaatttattaagcattttgattaattgataa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
52718364 |
caaagggaacaataccttggggaagtgcagcctgcaaattaaaatcaaacaaaattatggtaacaaactgaatatattaagcattttgat--------aa |
52718273 |
T |
|
| Q |
115 |
actgaatttaatttcacatacctgaacaattgcaacatgtaacagaactccacggataccaattgctattgaggttgccgcaatcacagctggaccggtc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52718272 |
actgaatttaatttcacatacctgaacaattgcaacatgtaacagaactccacggataccaattgctattgaggttgccgcaatcacagctggaccggtc |
52718173 |
T |
|
| Q |
215 |
aagaaccttac |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
52718172 |
aagaaccttac |
52718162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 134 - 225
Target Start/End: Complemental strand, 52712599 - 52712508
Alignment:
| Q |
134 |
acctgaacaattgcaacatgtaacagaactccacggataccaattgctattgaggttgccgcaatcacagctggaccggtcaagaaccttac |
225 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||| ||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52712599 |
acctgaacaattgcaacatgtaagagaactccacggagaccaactgctaacgaggttgccgcaatcacagctggaccgaccaagaaccttac |
52712508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University