View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_low_40 (Length: 241)
Name: NF12001_low_40
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 225
Target Start/End: Original strand, 45289203 - 45289388
Alignment:
| Q |
39 |
gaaaaggtaaaatatggattaaaagacactaagcacaattagtgtaacgatgtgcnnnnnnnctacataatctttgtaagtaatcctcaataaggaatag |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45289203 |
gaaaaggtaaaatatggattaaaagacactaagcacaattagtgcaacgatgtgcaaaaaaactacataatctttgtaagtaagcctcaataaggaatag |
45289302 |
T |
 |
| Q |
139 |
aaagcaccaattacatccctaataatcaaaattagaccccaatcatcactttttggtggtgaggtgtttgatatggccactgctgag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45289303 |
aaagcaccaattacatccctaataaacaaaattagaccccaaccatcac-ttttggtggtgaggtgtttgatatggccaccgctgag |
45289388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University