View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12001_low_47 (Length: 235)
Name: NF12001_low_47
Description: NF12001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12001_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 7328504 - 7328300
Alignment:
| Q |
13 |
aagaagaggtggtcatgcagcacgggtcaattcaacctcataagcttttgcatatcgaaagctagaaaagaaagaaacagaaacattggcaagtttttaa |
112 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
7328504 |
aagaagagatggtcatgcagcaccggtcaattcaacctcataagcttttgcatatcgaaggctagaaaagaaagacacagcaacgttggcaagtttttaa |
7328405 |
T |
|
| Q |
113 |
gactcaaatttggttctagtaccggaaaagcattcaaaaagagagcagcaaagtgtgctcttgctaaaataattacaggtgcttggctttcctatcagaa |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7328404 |
gactcaaatttggttctagtactggaaaagcattcaaaaagagagcagcaaagtgtgctcttgctaaaataattacaggtgcttggctgtcctatcagaa |
7328305 |
T |
|
| Q |
213 |
gtaca |
217 |
Q |
| |
|
||||| |
|
|
| T |
7328304 |
gtaca |
7328300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 22 - 217
Target Start/End: Complemental strand, 6806307 - 6806112
Alignment:
| Q |
22 |
tggtcatgcagcacgggtcaattcaacctcataagcttttgcatatcgaaagctagaaaagaaagaaacagaaacattggcaagtttttaagactcaaat |
121 |
Q |
| |
|
||||||||||| | ||||||||||||||||| ||||||||| ||| ||||||||||||| ||||| || | || |||||||| ||||||| | ||||| |
|
|
| T |
6806307 |
tggtcatgcagtattggtcaattcaacctcatgagcttttgcttattgaaagctagaaaaaaaagacacggcaaacttggcaagcttttaaggcacaaat |
6806208 |
T |
|
| Q |
122 |
ttggttctagtaccggaaaagcattcaaaaagagagcagcaaagtgtgctcttgctaaaataattacaggtgcttggctttcctatcagaagtaca |
217 |
Q |
| |
|
|||||| | | || ||| |||||||||||| ||||| ||||||| | ||| | || | ||||||| || |||||| |||||||||||||||| |
|
|
| T |
6806207 |
ttggtttgaattgggggaaaacattcaaaaagaaagcagaaaagtgttgtgttgttcaagtgattacagatgtttggctatcctatcagaagtaca |
6806112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University