View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12002_low_5 (Length: 299)
Name: NF12002_low_5
Description: NF12002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12002_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 43996576 - 43996857
Alignment:
| Q |
1 |
tcctgaagtgattttaataaagaagagttataaagagaagagatgtgggaagcctcgttcttggaaattacttcctatggaggttgatgataaggttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43996576 |
tcctgaagtgattttaataaagaagagttataaagagaagagatgtgggaagcctcgttcttggaaatcacttcctatggaggttgatgataaggttgga |
43996675 |
T |
|
| Q |
101 |
gttgattacaacttggaacgtgatctattcttaaaggaccctgaattggaggagttgatggctggttttgaatcccttgatctgtttgaggatgaagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43996676 |
gttgattacaacttggaacgtgatctattcttaaaggaccctgaattggaggagttgatggctggttttgaatcccttgatctgtttgaggatgaagatg |
43996775 |
T |
|
| Q |
201 |
aggaggataacatggaagaataagctaaagtcacttctatcctaattatatactgaatcttagttttattgttgtcaaggat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43996776 |
aggaggataacatggaagaataagctaaagtcacttctatcctaattatatactgaatcttagttttattgttgtcaaggat |
43996857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University