View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12003_high_11 (Length: 303)
Name: NF12003_high_11
Description: NF12003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12003_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 2 - 150
Target Start/End: Complemental strand, 40043709 - 40043561
Alignment:
| Q |
2 |
ctttcatcattgacgaagacctgcgctaataagacaaagaagtggggagtctatgccttttcataaaactaaaagctttcagtccttgaatgaatcagta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40043709 |
ctttcatcattgacgaagacctgcgctaataagacaaagaagtggggagtctatgccttttcataaaactaaaagcttttagtccttgaatgaatcagta |
40043610 |
T |
|
| Q |
102 |
acaacgaattcgtggaatgagggatcaagaaacggatagggaggggaat |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043609 |
acaacgaattcgtggaatgagggatcaagaaacggatagggaggggaat |
40043561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 128 - 296
Target Start/End: Complemental strand, 42445247 - 42445079
Alignment:
| Q |
128 |
aagaaacggatagggaggggaatggcctttccattattggtggaccttcccttgaattgaaccggtcacggagctctccattgagttgtttaggttctgg |
227 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
42445247 |
aagaaacagatagggaggggaatggactttccattattggtggaccttcccttgaattgaaccggtcacggagctctctcttaagttgtttaggttctgg |
42445148 |
T |
|
| Q |
228 |
aattccatctctagttgggggtttcagttcgaaggttatcaaatgtggtgcgggttcatctcactcgac |
296 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42445147 |
aattccatctctagttgggggtttaagttcgaaggttatcaaatgtggtgcgggttcatctctctcgac |
42445079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 160 - 296
Target Start/End: Complemental strand, 19008132 - 19007996
Alignment:
| Q |
160 |
attattggtggaccttcccttgaattgaaccggtcacggagctctccattgagttgtttaggttctggaattccatctctagttgggggtttcagttcga |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
19008132 |
attattggtggaccttcccttgaattgaaccaatcacagagctctccattgagatgtttaggttctggaattccatgtctagttgggagtttcagttcga |
19008033 |
T |
|
| Q |
260 |
aggttatcaaatgtggtgcgggttcatctcactcgac |
296 |
Q |
| |
|
|||||||||||| || ||| | ||||||| |||||| |
|
|
| T |
19008032 |
aggttatcaaatatgatgcatgctcatctctctcgac |
19007996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 161 - 296
Target Start/End: Original strand, 22057307 - 22057443
Alignment:
| Q |
161 |
ttattggtggaccttcccttgaattgaaccggtcacggagctctccattgagttgtttaggttctggaattccatctctagttgggggtttcagttcgaa |
260 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||| ||| ||||||||| || |||||||||||| ||||||||||||| ||| |||||||||||||||| |
|
|
| T |
22057307 |
ttattggtggaacttcccttgaattgaaccagtcatggaactctccatttagatgtttaggttctagaattccatctcttgttaggggtttcagttcgaa |
22057406 |
T |
|
| Q |
261 |
ggttatc-aaatgtggtgcgggttcatctcactcgac |
296 |
Q |
| |
|
||| ||| |||||||||| ||||||||| |||||| |
|
|
| T |
22057407 |
ggtcatcaaaatgtggtgtatgttcatctctctcgac |
22057443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University