View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12005_low_6 (Length: 250)
Name: NF12005_low_6
Description: NF12005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12005_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 24066208 - 24066423
Alignment:
| Q |
1 |
aataattggttaatatagtggcatagattccataaatgattattaataatgattcaccttgcacttcaatcaaatactatagtaacttatcatctttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| | |
|
|
| T |
24066208 |
aataattggttaatatagtggcatagattccataaatgattattaataatgattcaccttgcacttcagtcaaatactata---actcct---------- |
24066294 |
T |
|
| Q |
101 |
gtttcttcaaaaaagagaaagtgacattacgtgtgtttgattagataattatcatctttaatgtttttataagaattgcttttatctttattaacagtct |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24066295 |
-----ttcaaaaaagtgaaagtgacattacgtgtgtttgattagataattatcatctttaatgtttttataagaattgcttttatctttattaacagtct |
24066389 |
T |
|
| Q |
201 |
atttcnnnnnnnntctttattaacagttggtccc |
234 |
Q |
| |
|
||||| |||||||||||||| |||||| |
|
|
| T |
24066390 |
atttcaaaaaaaatctttattaacagtcggtccc |
24066423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University