View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12006_high_1 (Length: 481)
Name: NF12006_high_1
Description: NF12006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12006_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 451; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 451; E-Value: 0
Query Start/End: Original strand, 17 - 471
Target Start/End: Original strand, 30804570 - 30805024
Alignment:
| Q |
17 |
acgagccactgatctggtttcaaaactcgatatagcttcgataacagacaccggagagagaaaactgcttttagatctgaatttggctcggtcccgaaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804570 |
acgagccactgatctggtttcaaaactcgatatagcttcgataacagacgccggagagagaaaactgcttttagatctgaatttggctcggtcccgaaca |
30804669 |
T |
 |
| Q |
117 |
gcttgggaggttcgggatcagaaccttgctattgcgttactgaaccgaagcaaaagcatggtttctggttcgagtgagaattacatggaactagcgaagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804670 |
gcttgggaggttcgggatcagaaccttgctattgcgttactgaaccgaagcaaaagcatggtttctggttcgagtgagaattacatggaactagcgaagc |
30804769 |
T |
 |
| Q |
217 |
agtttatgtcgttcgggaaatgttccctcgccgcgaacagtgatttgagcgaggcgttgaagttgatgaacgaggcgttggagaattgtgagaagggatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804770 |
agtttatgtcgttcgggaaatgttccctcgccgcgaacagtgatttgagcgaggcgttgaagttgatgaacgaggcgttggagaattgtgagaagggatt |
30804869 |
T |
 |
| Q |
317 |
cggtgcagcgaggacacgggaagagaaggtggagattcgaggtttgaggtggaaggttttgaggtttatagcggcgattcatttgcagaaagaggaattt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804870 |
cggtgcagcgaggacacgggaagagaaggtggagattcgaggtttgaggtggaaggttttgaggtttatagcggcgattcatttgcagaaagaggaattt |
30804969 |
T |
 |
| Q |
417 |
gagagtgtggttaagtgtgtgaaggttttgagagattctgctgaaggtggtgatg |
471 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30804970 |
gagagtgtggttaagtgtgtgaaggttttgagagattctgctgaaggtggtgatg |
30805024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University