View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12006_low_4 (Length: 337)
Name: NF12006_low_4
Description: NF12006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12006_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 23 - 322
Target Start/End: Original strand, 45398117 - 45398416
Alignment:
| Q |
23 |
tcagcacctgacttatccttaaaagtagaagcatctagatccgccattaacagcaacttccccacctcatcgtccgttagctttattcccctcagttgtg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398117 |
tcagcacctgacttatccttaaaagtagaagcatctagatccgccattaacagcaacttccccacctcatcgtccgttagctttattcccctcagttgtg |
45398216 |
T |
 |
| Q |
123 |
gaccatatctcacgttgtccgcaactgtaccttcaaagagagcagggagctgaaagagcatggcgaccttacggcggagggaaagaacgtcaaggttaca |
222 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398217 |
gtccatatctcacgttgtccgcaactgtaccttcaaagagagcagggagctgaaagagcatggcgaccttacggcggagggaaagaacgtcaaggttaca |
45398316 |
T |
 |
| Q |
223 |
tatgtctacgccatcgaggaagacggaggaggaaggtggctcccagaggcgattcatggcccttaagagggttgacttgccgctaccactaggacctatg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45398317 |
tatgtctacgccatcgaggaagacggaggaggaaggtggctcccagaggcgattcatggcccttaagagggttgacttgccgctaccactaggacctatg |
45398416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University