View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12008_high_8 (Length: 265)
Name: NF12008_high_8
Description: NF12008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12008_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 3685882 - 3685664
Alignment:
| Q |
20 |
tcatctatcacttgttacacaacctttcatgcttggttgctcatcttatattgctagttatgcttcatcagtacgtggctgagcatcacctgttactgtt |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
3685882 |
tcatctatcacttgttacgcaacctttcatgcttggttgctcatcttatattgctagtcgtgcttcatcagtacgtggttgaaaatcacctgttactgtt |
3685783 |
T |
 |
| Q |
120 |
aattcagattgcacaactatatgttcattgactggaggtgaacatttcgagcaaatggtgtcttaattgctttcgaaaaacctatgcatgcagggttatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685782 |
aattcagattgcacaactatatgttcattgactggaggtgaacatttcgagcaaatggtgtcttaattgctttcgaaaaacctatgcatgcagggttatc |
3685683 |
T |
 |
| Q |
220 |
ttttgcttgcctggtttct |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3685682 |
ttttgcttgcctggtttct |
3685664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University