View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12009_high_24 (Length: 325)
Name: NF12009_high_24
Description: NF12009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12009_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 14131003 - 14130814
Alignment:
| Q |
16 |
gaggacaaagtgaggatgagcagggtggaatgcatccaccacgagacaagctgcgc-ggtcgatatatccaggaagggatatgcagagagggaaggggc- |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14131003 |
gaggacaaagtgaggatgagcagggtggaatgcatccaccacgagacgagctgcgccggtcgatatatccaggaagggatatgcagagagggaaggggcc |
14130904 |
T |
|
| Q |
114 |
---agagctaagattaaaggattaaggagctaactatgataattaaaattcatcttaaaatatggaggtggtgatgagattatttttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14130903 |
agcagagctaagattaaaggattaaggagctaactatgataattaaaattcattttaaaatatggaggtggtgatgagattttttttttt |
14130814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 261 - 325
Target Start/End: Complemental strand, 14130807 - 14130743
Alignment:
| Q |
261 |
acggtatcatctgtaatgttatggggataaatatttaattgcactagggtttggttggcttttcc |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14130807 |
acggtatcatctgtaatgttatggggataaatatttaattgcactagggtttggttggcttttcc |
14130743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University