View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12009_high_31 (Length: 304)
Name: NF12009_high_31
Description: NF12009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12009_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 394612 - 394538
Alignment:
| Q |
30 |
ttatgaacagtggaggacggtggggtggggtacggcagcgcaggaggaagacgtttggtgtgtttctactttcta |
104 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394612 |
ttatgaacagtggaggacggtggggtgaggtacggcagcgcaggaggaagacgtttggtgtgtttctactttcta |
394538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 209 - 304
Target Start/End: Complemental strand, 394490 - 394390
Alignment:
| Q |
209 |
ggctaattatgtttgcaaagtaacaaaatagaaatta----tctgtaccaaaaaata-ttaaaaatagaaattatattcattttttgttggtacgaatta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||| | |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
394490 |
ggctaattatgtttgcaaagtaacaaaatagaaattaattatttgtaccaaaaaaaaattaaaaatagaaattatattcattttttgttggtacaaatta |
394391 |
T |
|
| Q |
304 |
g |
304 |
Q |
| |
|
| |
|
|
| T |
394390 |
g |
394390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 394528 - 394481
Alignment:
| Q |
147 |
acgtatcactctcaactagctctttgttccgagccgcaggttaattat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
394528 |
acgtatcactctcaactagctctttgttccgagccacaggctaattat |
394481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University