View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12009_low_1 (Length: 236)

Name: NF12009_low_1
Description: NF12009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12009_low_1
NF12009_low_1
[»] chr2 (2 HSPs)
chr2 (2-90)||(14130814-14130902)
chr2 (154-218)||(14130743-14130807)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 2 - 90
Target Start/End: Complemental strand, 14130902 - 14130814
Alignment:
2 gcagagctaagattaaaggattaaggagctaactatgataattaaaattcatcttaaaatatggaggtggtgatgagattatttttttt 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||    
14130902 gcagagctaagattaaaggattaaggagctaactatgataattaaaattcattttaaaatatggaggtggtgatgagattttttttttt 14130814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 154 - 218
Target Start/End: Complemental strand, 14130807 - 14130743
Alignment:
154 acggtatcatctgtaatgttatggggataaatatttaattgcactagggtttggttggcttttcc 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14130807 acggtatcatctgtaatgttatggggataaatatttaattgcactagggtttggttggcttttcc 14130743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University