View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1200_high_18 (Length: 319)
Name: NF1200_high_18
Description: NF1200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1200_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 8e-58; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 46 - 187
Target Start/End: Original strand, 12814176 - 12814316
Alignment:
| Q |
46 |
tatgacttcatcactttgttttccactcttaagtatataccaccaattattttgcatatgtaacactgtaggaaaagaatcaagatgatgttttggaaat |
145 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
12814176 |
tatgacatcatcactttgttttccactct-aagtatatatcaccaattactttgcatatgtaacattgtaggaaaaaaatcaagatgatgttttggaaat |
12814274 |
T |
 |
| Q |
146 |
agtttttcttgcatataaatgatgtgtttagcagtagaaatg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12814275 |
agtttttcttgcatataaatgatgtgtttagcagtagaaatg |
12814316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 244 - 305
Target Start/End: Original strand, 12814373 - 12814434
Alignment:
| Q |
244 |
gtaatgataatttcttttgtgtattctcttttcactttctcttattagttaaagtattatat |
305 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12814373 |
gtaatgataatttcttatgtgtattctcttttgactttctcttattagttaaagtattatat |
12814434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 12814035 - 12814084
Alignment:
| Q |
1 |
aaacttacgggtagtctctggacctaaaattgatttcaaacaagatatga |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12814035 |
aaacttacgggtagtctctggacctaaaattgatttcaaacaagatatga |
12814084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University